ID: 930094477

View in Genome Browser
Species Human (GRCh38)
Location 2:47556505-47556527
Sequence ACCAGCTGGACACTCCACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930094477_930094481 3 Left 930094477 2:47556505-47556527 CCAGTGTGGAGTGTCCAGCTGGT 0: 1
1: 0
2: 0
3: 10
4: 120
Right 930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930094477 Original CRISPR ACCAGCTGGACACTCCACAC TGG (reversed) Intronic
902886394 1:19407868-19407890 ACCAGCTGCACAGTCCGCCCTGG - Intronic
903177020 1:21587403-21587425 AGCTGCTGGGCACTCCCCACAGG - Intergenic
905304863 1:37010603-37010625 TACAGCCGGACACTGCACACTGG - Intronic
906943113 1:50273078-50273100 ACCAGCTGCTCACTCCCCAAAGG - Intergenic
907784865 1:57601529-57601551 TCCAGCTGGAGACTCCAGTCTGG - Intronic
916024688 1:160823513-160823535 AGAAGCTGGACACTCCCCTCAGG + Exonic
924596477 1:245449336-245449358 ACAAGCTGGACACACCACAAAGG + Intronic
1066251547 10:33637776-33637798 ACCAGCTGGTCACTCCTCTCTGG - Intergenic
1070436928 10:76402639-76402661 ACCAGCTGGACCATGCACAGTGG - Intronic
1070758146 10:79006188-79006210 ACCAGCTCCACACTCCTCAAAGG + Intergenic
1070959977 10:80491895-80491917 AGCTGCTGGACCCTCCCCACTGG + Intronic
1073313001 10:102557574-102557596 CACAACTGGACACTCCACCCTGG + Intronic
1075733506 10:124650354-124650376 TCCAGTTGGACCCTCCACGCTGG + Intronic
1077267236 11:1657236-1657258 ACCAGCAGGACACCCCACTCAGG - Intergenic
1078057595 11:8019818-8019840 GCCAGCGGGACACTCCGCCCGGG - Intronic
1079138598 11:17792452-17792474 ACCAGCAGGACACAGCACAGTGG + Intronic
1081933094 11:46886137-46886159 GCCAGCTGGGCTCTCCAAACTGG + Exonic
1083151353 11:60793755-60793777 GCCAGCTGGACCCTCCTCAGTGG + Intronic
1085127524 11:74011759-74011781 TCCAGCTGCACACTGCTCACAGG + Intergenic
1088225766 11:107618163-107618185 AGCATCTGGACAGTCAACACGGG + Exonic
1088519515 11:110679888-110679910 AACAGCTGGTCACTCCAGAATGG + Intronic
1093591025 12:20903028-20903050 ACCAACTGCACACTCCAGCCTGG + Intronic
1094664197 12:32502131-32502153 ACCATCTGTTCACTCCCCACCGG + Intronic
1098545558 12:71707525-71707547 ACCATCTGGTCACTCCTCTCTGG + Intergenic
1099248487 12:80222425-80222447 ACCAGCTGGACATATCTCACTGG - Intronic
1104684860 12:130778127-130778149 AGCATTTGGACACTCAACACTGG - Intergenic
1104686319 12:130787400-130787422 CCCAGCTGCCCACGCCACACAGG + Intergenic
1109458523 13:62625388-62625410 ACCAGCCGGCCACTCCTCTCTGG + Intergenic
1111452248 13:88434645-88434667 TCCAGCTGGTCCCTCCACTCGGG - Intergenic
1113717475 13:112522645-112522667 GACAGCTGGACATTCCACAAAGG + Intronic
1115062805 14:29214128-29214150 ACTAGCATGACAATCCACACTGG - Intergenic
1116655658 14:47650436-47650458 AGAACCTGCACACTCCACACAGG - Intronic
1118750879 14:68807272-68807294 ACCAACTGCACCCTCCACCCCGG + Intergenic
1119323303 14:73744213-73744235 CCCAGCTGCACACCCAACACTGG + Intronic
1120868052 14:89312346-89312368 TACAGCTGGCCAATCCACACGGG + Intronic
1124208201 15:27741181-27741203 ACCAACTGGACACTTCAAAATGG + Intergenic
1126362853 15:47864136-47864158 AACAGCTAGAAACTCAACACAGG + Intergenic
1126701910 15:51375682-51375704 GCCATGTGGACACTCCCCACTGG - Intronic
1128577775 15:68788162-68788184 ACCAGGGGGCCACTCCAGACAGG + Intronic
1129619727 15:77133109-77133131 ACCAGCTGTCCACTCCAAAACGG + Exonic
1131378966 15:91948255-91948277 ACCAGCTGGTCCCTCCACAGTGG + Intronic
1133475831 16:6121108-6121130 ACCAGGTGCACACTCCCAACAGG - Intronic
1135958567 16:26977054-26977076 CCCAGCTGGCCACTCCTCCCAGG - Intergenic
1137837922 16:51611590-51611612 CCCAGCTGAAAACTCAACACAGG - Intergenic
1138658185 16:58502485-58502507 GCCAGCTTGTCACTCCACACTGG + Intronic
1139463428 16:67141057-67141079 ACCAGCTGGACTGTCCGCACTGG - Intronic
1139548401 16:67660384-67660406 ACCAGCGGGAGTCTGCACACAGG - Exonic
1141656893 16:85421360-85421382 ACCCTCTGGACACTCAGCACCGG + Intergenic
1142058244 16:88014021-88014043 TCCTGCTGGACACTCCAGGCGGG + Intronic
1144043233 17:11431284-11431306 GACAGCTGCACCCTCCACACAGG + Intronic
1144872438 17:18379458-18379480 AGGAGCTGCACACTCCACCCTGG - Intronic
1145994046 17:29095559-29095581 ACCACCCGGACACCCCATACTGG + Intronic
1148560246 17:48601975-48601997 TCCTGTTGGACCCTCCACACCGG - Intronic
1151746355 17:76013889-76013911 ACCAGATGGGCAGACCACACAGG - Intronic
1152404174 17:80087090-80087112 ATCCGCTGGCCACTCCTCACAGG - Intronic
1152542339 17:80982548-80982570 TCCAGCTGGTCCCTCCACCCAGG - Intergenic
1154102220 18:11486722-11486744 ACCAGGCGGACACTCTACAAGGG - Intergenic
1155667963 18:28334455-28334477 ACAATCTGTACACTCCACAAAGG - Intergenic
1157740439 18:50088121-50088143 AACAGCAGGTCACCCCACACCGG - Intronic
1158864081 18:61620325-61620347 CCCATCTGAACACTCCACGCTGG + Intergenic
1161761122 19:6173383-6173405 ACCAGGTGGTCAGTTCACACAGG - Intronic
1167147711 19:47693160-47693182 ACCAGCTGTGCACCCAACACTGG - Intronic
1168353164 19:55687826-55687848 CCCTGCTGGGCACACCACACGGG + Intronic
925670170 2:6302672-6302694 ACCACCTGGAGACCCCACAGAGG - Intergenic
925708286 2:6712220-6712242 ACCTGCTTGCCAATCCACACTGG - Intergenic
928965216 2:36968915-36968937 ACAACCTGGACACTCTCCACCGG + Intronic
930094477 2:47556505-47556527 ACCAGCTGGACACTCCACACTGG - Intronic
931207813 2:60165011-60165033 ACCAGATGGAGACTCCCCCCAGG + Intergenic
947071302 2:226290975-226290997 TCCAGCTGGTCCCTCCACATGGG - Intergenic
948262210 2:236612838-236612860 GCCAGCTGGGCACGCCAGACAGG - Intergenic
948595661 2:239077707-239077729 ACCCGCTGCACACACCACGCTGG - Intronic
1170608834 20:17895215-17895237 GCCAGCTGGACACCTCACACCGG + Intergenic
1173165417 20:40683967-40683989 GGCAGCTGGTCACTCCAAACCGG + Intergenic
1174145672 20:48450882-48450904 CACAGCAGGACCCTCCACACTGG - Intergenic
1176294560 21:5064468-5064490 TCCAGACAGACACTCCACACAGG - Intergenic
1176365403 21:6029800-6029822 GCCTGCTGGACACTGGACACCGG + Intergenic
1179758115 21:43508745-43508767 GCCTGCTGGACACTGGACACCGG - Intergenic
1179862492 21:44197658-44197680 TCCAGACAGACACTCCACACAGG + Intergenic
1179943425 21:44654449-44654471 AGCAGGTGGATACCCCACACAGG + Exonic
1181456833 22:23064579-23064601 AGCTGCTGGAGACCCCACACTGG + Intronic
1181536176 22:23546921-23546943 ACCAGCTGGTCCCTCCATTCGGG - Intergenic
1181921876 22:26326974-26326996 ACCCCCAGGAAACTCCACACAGG - Intronic
1182443931 22:30379574-30379596 CCCAGCTGGACTCTGCACATGGG - Exonic
1184413283 22:44338040-44338062 ACCAGCTGGTCGCACCAAACCGG - Intergenic
1184479068 22:44736689-44736711 ACCTGCTGCTCACTGCACACTGG - Intronic
950769029 3:15296220-15296242 ACCAACTGTATACTCCACAGTGG + Intronic
956120833 3:65964369-65964391 ATCACCTTGACACTCCAAACAGG + Intronic
959813931 3:110652950-110652972 ACCAGCTGGTCCCTCCTCTCTGG - Intergenic
965103615 3:164333467-164333489 ACCGGCTGGTCACTCCTCTCTGG + Intergenic
965458520 3:168932502-168932524 ACCTGCAGGACCCTCCCCACTGG - Intergenic
966773713 3:183525923-183525945 AACAGCAGGACACTGCAAACAGG + Intronic
967290341 3:187913693-187913715 GCCAGCTGCACACTCCCCTCAGG + Intergenic
968580942 4:1394749-1394771 AGCAGGTGGGCACTCCACATGGG - Exonic
970613023 4:17743073-17743095 AGCTGCTGGCCACTCCTCACAGG - Intronic
984541688 4:181046295-181046317 ACCAACTGTACACTCTACAATGG - Intergenic
985570098 5:640056-640078 GACAGCTGGCAACTCCACACTGG - Intronic
987112666 5:14701812-14701834 ACCAGCCTGACACTTAACACGGG - Intergenic
992618115 5:78565093-78565115 ACAAGCTGGACATTCCCCCCTGG - Intronic
992627598 5:78648976-78648998 ACCCGCAGGACACTCCCCTCCGG - Intronic
993429635 5:87815613-87815635 ACCAACTGGCCACACCTCACGGG - Intergenic
998885761 5:146692287-146692309 TCCAGCTGGAGACTCCATAGAGG - Intronic
1002687459 5:181024820-181024842 ACCAGCCAGGCACTCCACCCAGG + Intergenic
1002942640 6:1731815-1731837 ACCTTCTGGGCAGTCCACACGGG + Intronic
1002991593 6:2244216-2244238 ACCAACTGGACACTTCCCAGCGG + Intronic
1005213123 6:23492544-23492566 ACAAGGTGGACACTCCAGAGAGG - Intergenic
1006768343 6:36529411-36529433 AATAGCAGGACTCTCCACACAGG + Intronic
1013185814 6:107757092-107757114 ACCAGCTGGAGTCTCCACCAGGG + Intronic
1017782395 6:157725978-157726000 ACCAGCTGGTCACTCCTCTCTGG - Intronic
1018497026 6:164359227-164359249 ACCAGCTGGTCACTCCTCTCTGG + Intergenic
1019509175 7:1408735-1408757 GCCAAGTGGACACTCCACATGGG - Intergenic
1030528796 7:110686479-110686501 GCCAGCTGGACAATCCCAACAGG + Intronic
1030952448 7:115808194-115808216 ACAAGATGCACCCTCCACACAGG + Intergenic
1032281343 7:130504836-130504858 ACCCTGTGGACACACCACACTGG - Intronic
1035713250 8:1734570-1734592 ACCGGCTGGCCAGTCCAGACAGG + Intergenic
1038129369 8:24712534-24712556 ACCACCTGGACAGTCCAGAAGGG - Intergenic
1040385279 8:46911093-46911115 ACCAGCTGGAGCAGCCACACTGG - Intergenic
1041409945 8:57542476-57542498 CCCTGCTGGACTCTCAACACAGG - Intergenic
1042925546 8:73964587-73964609 ACCAGCCGGGCACTCCAGCCTGG + Intronic
1045115304 8:98974194-98974216 TCCAGCTCGACCCTCCCCACAGG + Intergenic
1045662026 8:104448054-104448076 GACAGCTGGAGACTCCACTCTGG + Intronic
1046976937 8:120289745-120289767 ACCAGGTGGAAACTCTGCACCGG + Exonic
1049704654 8:144035679-144035701 ACCGGCTGGCCCCTCCACAGCGG + Intronic
1052653811 9:31331857-31331879 ACCTGCAGGATCCTCCACACTGG + Intergenic
1055993487 9:82132278-82132300 ACCAGATGGACACTACATATAGG + Intergenic
1057394397 9:94666897-94666919 CTCAGCTGGACACTGAACACGGG + Intergenic
1057757140 9:97847790-97847812 GCCAGCTGCACACTCCAGCCGGG - Intergenic
1061881237 9:133570271-133570293 CCCAGCAGGACCCTACACACAGG - Intronic
1062179839 9:135185430-135185452 ACCAGATGGACACCCCACATAGG + Intergenic
1185466754 X:359362-359384 AGCAGGTGCTCACTCCACACGGG + Intronic
1200237732 X:154476823-154476845 TCCACCAGGAAACTCCACACAGG - Intergenic
1201909021 Y:19114573-19114595 AGCAGCTGGAAAGTCCAAACTGG - Intergenic