ID: 930094481

View in Genome Browser
Species Human (GRCh38)
Location 2:47556531-47556553
Sequence CAGGGTCACCAATTTAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930094477_930094481 3 Left 930094477 2:47556505-47556527 CCAGTGTGGAGTGTCCAGCTGGT 0: 1
1: 0
2: 0
3: 10
4: 120
Right 930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930094481 Original CRISPR CAGGGTCACCAATTTAAAGT TGG Intronic
905385529 1:37600988-37601010 CATGGTCACCACTTCTAAGTGGG + Intergenic
905861286 1:41353718-41353740 CAAGGTCACCAAGTTACAGCCGG + Intergenic
908811950 1:67990626-67990648 CAAGGTCACAAATTTAAAAGAGG + Intergenic
909302733 1:74033866-74033888 CAGGGTGTCCATTTTGAAGTAGG - Intronic
912504663 1:110148065-110148087 CATGGCCACCAACTTCAAGTGGG - Intergenic
920839725 1:209544534-209544556 CAGGGCTACCAAGTGAAAGTGGG - Intergenic
921484706 1:215702447-215702469 CAGGTACACCAATTAAATGTAGG + Intronic
923510204 1:234644659-234644681 CATGCTCTCCAATTTGAAGTGGG + Intergenic
1063338145 10:5236283-5236305 CAGGTACACCAATCTAATGTAGG - Intergenic
1065651890 10:27900827-27900849 CAGGTACACCAATCAAAAGTAGG - Intronic
1066283828 10:33944580-33944602 CAGGGTTCTCAATGTAAAGTCGG - Intergenic
1068047993 10:51912160-51912182 CAGACACACCATTTTAAAGTAGG + Intronic
1075615353 10:123886890-123886912 CAGGGTCATCAATTTGAAGATGG + Intronic
1077726027 11:4675822-4675844 AAATGGCACCAATTTAAAGTGGG - Intergenic
1079821518 11:25136658-25136680 CAGTGTCACCAATTTAACAGCGG + Intergenic
1081080067 11:38730740-38730762 CAGGTCCACCAATTAAATGTAGG + Intergenic
1083499333 11:63088938-63088960 CAGGGACACCAATTTATCGTAGG - Intronic
1087511867 11:99104786-99104808 CATGGGCACAAATTTAAAGAAGG + Intronic
1087573338 11:99959213-99959235 CATGATCATCAATTTCAAGTGGG + Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1089333842 11:117709146-117709168 CAGGGTCACACATTGAAACTAGG - Intronic
1094266792 12:28568738-28568760 CAGGGTCTCCATTTTTAAGGAGG - Intronic
1095426069 12:42075864-42075886 CATGGCCATGAATTTAAAGTAGG + Intergenic
1095917671 12:47496480-47496502 TACAGTCATCAATTTAAAGTTGG - Intergenic
1098398022 12:70042824-70042846 TATAGTCACAAATTTAAAGTGGG + Intergenic
1101259802 12:103017379-103017401 CAGGGTCAATAATTTAGAATGGG + Intergenic
1101437610 12:104677591-104677613 CAGGGTGTCCATTTGAAAGTGGG + Intronic
1102932561 12:116873917-116873939 CAGGGGCACCAGTTTAGAGCAGG + Intronic
1105769567 13:23595623-23595645 CAGGGACACCAATAAAATGTAGG - Intronic
1107968697 13:45620992-45621014 CAGGGACACCAATCAAACGTAGG + Intergenic
1109357799 13:61253859-61253881 CTTGGTGACTAATTTAAAGTGGG + Intergenic
1111415270 13:87933039-87933061 CAGGGTTAGCATTGTAAAGTGGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112346720 13:98596289-98596311 CAGGGTCACCAGTCTCAAATGGG + Intergenic
1112912484 13:104505126-104505148 CAGGTTCCCCTATTTAAAATTGG - Intergenic
1113738073 13:112691719-112691741 CAAGGTCTCCTATTTAAAGAAGG - Intronic
1114213887 14:20640933-20640955 GAGGGTCACCACTATCAAGTGGG + Exonic
1117062195 14:51974520-51974542 CAGGGGCACCAATTTTCACTGGG - Intronic
1117925414 14:60774041-60774063 CAGGGTCATCAATTTTAGATTGG + Intronic
1120163720 14:81171998-81172020 CATGCTCACATATTTAAAGTGGG + Intergenic
1126470604 15:49006375-49006397 CAGGTACACCAATCTAACGTAGG + Intronic
1127056441 15:55136718-55136740 CAGGTACACCAATTAAAGGTAGG - Intergenic
1127831044 15:62751670-62751692 CAGGGTGCCCAATGTAAATTTGG - Intronic
1128447078 15:67772987-67773009 AAGGGTCACAAACTTAATGTAGG + Intronic
1130796859 15:87218762-87218784 CAGGGTCCCCAGTTTGAAATTGG + Intergenic
1131011119 15:89019280-89019302 CAGGGTCAACAATGCAAAGCAGG + Intergenic
1134607514 16:15582747-15582769 AAGGATCACCAAGATAAAGTAGG - Intronic
1140863868 16:79042464-79042486 CAGGCTGACCAATTTACACTGGG - Intronic
1153791351 18:8582573-8582595 TAGGGCCACCAGTTTTAAGTGGG - Intergenic
1159322417 18:66869653-66869675 CATAGTCACATATTTAAAGTAGG - Intergenic
1162322817 19:9979873-9979895 CAGGGTCACCAAGGTAAAGATGG - Exonic
925793485 2:7518034-7518056 CAGGGTAACTGATTTAATGTGGG + Intergenic
926044402 2:9699068-9699090 CAGTGTCCCCATTTTAAAGAGGG + Intergenic
926524188 2:13955926-13955948 CAGTCTCCCCAATTAAAAGTTGG - Intergenic
926668547 2:15552017-15552039 CAGGATCACAGATTTAAAATAGG - Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
931908023 2:66863680-66863702 CAGGGTTATCAATTTTCAGTGGG + Intergenic
933243063 2:79944383-79944405 CTGAGTCATCACTTTAAAGTTGG - Intronic
933751584 2:85605678-85605700 CAGGCTCACAAATTTAAATGAGG - Intronic
935074636 2:99729076-99729098 CAGTTTCACCAAATTAAAGCAGG - Intronic
939330545 2:140753831-140753853 TAGGCTCAGCAATTTAGAGTTGG - Intronic
943591131 2:189798235-189798257 GAGGGTCACCAATTTAACAACGG - Intronic
945712475 2:213316045-213316067 CAGGGTTGGCAATTTAAATTTGG - Intronic
946930616 2:224666787-224666809 CTGGGTCTCCAATTTACAGATGG - Intergenic
1170283211 20:14675067-14675089 CAGGTACACCAATCAAAAGTAGG - Intronic
1173374906 20:42474561-42474583 CAGGGTCACCCATTTGATTTGGG - Intronic
1178639186 21:34332581-34332603 CAGGGTCACCTGTTGAAAGGAGG + Intergenic
1179947904 21:44690998-44691020 CAGCTTCTCTAATTTAAAGTGGG + Intronic
949473552 3:4420913-4420935 CAGGGTCACCCAGCTAATGTTGG - Intronic
949731682 3:7121149-7121171 CAGGAACACTCATTTAAAGTTGG + Intronic
956329426 3:68089179-68089201 CAGGGCTAGCAATTTAAATTTGG + Intronic
959000809 3:100962067-100962089 CATGGTCACTAATCTCAAGTGGG + Intronic
963998406 3:151738621-151738643 CAGGTACACCAATCTAACGTAGG + Intronic
965017196 3:163173291-163173313 CAGGTACACCAATTAAATGTAGG + Intergenic
966548439 3:181178322-181178344 CAGAGGCATCAATGTAAAGTTGG - Intergenic
967682218 3:192377464-192377486 CAGATTCACCTATTTTAAGTGGG + Intronic
971355719 4:25893674-25893696 GAGGGTCAGCAATTTATATTGGG - Intronic
972163658 4:36256482-36256504 CAGGCTTTCCAATTTAAAGTAGG - Intergenic
973557480 4:52099368-52099390 TTGGGTCACAAATTTGAAGTTGG + Intergenic
977772326 4:100874398-100874420 CAGTGTTACATATTTAAAGTTGG - Intronic
978159684 4:105530679-105530701 TAAGGTCATGAATTTAAAGTGGG + Intergenic
991284076 5:64950654-64950676 AAAGTTCACCAATTTTAAGTAGG + Intronic
991350683 5:65717780-65717802 CACAGTCATGAATTTAAAGTGGG + Intronic
992665708 5:79006922-79006944 GTAGGTCAGCAATTTAAAGTTGG - Intronic
993070907 5:83162297-83162319 CAGGGTAACCAACTTTAAGAGGG - Intronic
1004817357 6:19326568-19326590 CAGAGTCACAAATTTACAGCTGG - Intergenic
1004999035 6:21222446-21222468 CAGGATCAACAAATTGAAGTTGG - Intronic
1005581252 6:27237479-27237501 CAGCTTCTTCAATTTAAAGTCGG - Intergenic
1006997214 6:38272517-38272539 CAGAGTCATCCATTTAAAATTGG - Intronic
1007194925 6:40052147-40052169 CAGGGTTAGCAATTAAAAGATGG + Intergenic
1007767832 6:44171394-44171416 CTGGGTCCCCAATATAATGTGGG + Intronic
1008077187 6:47157182-47157204 CAGGGTCAGCTGTCTAAAGTTGG - Intergenic
1013013359 6:106139793-106139815 CATGGGAACCTATTTAAAGTAGG - Intergenic
1013957072 6:115853825-115853847 CAGGTTCACCAATCCAATGTAGG - Intergenic
1014211389 6:118711934-118711956 CAAGGTCACCAAGTTACAGGTGG - Intergenic
1015003480 6:128249238-128249260 CAGGGTTATCAATTTCAATTGGG - Intronic
1016860372 6:148711979-148712001 CAGAGTCACCAATTGAGGGTGGG - Intergenic
1017907939 6:158769601-158769623 CAGGGTCACCCATTGAAGGTGGG - Intronic
1023171500 7:37394125-37394147 CAGGGACACTAATATAATGTTGG + Intronic
1025000382 7:55310953-55310975 GAGAAGCACCAATTTAAAGTGGG + Intergenic
1027755538 7:82206698-82206720 CAGGATCCCAAATTTAAAATAGG + Intronic
1029853092 7:103485048-103485070 CAGAGTACCTAATTTAAAGTAGG + Intronic
1038880741 8:31608024-31608046 CAGGGGCAGCAACTTAAAGGGGG + Intergenic
1039263454 8:35798523-35798545 CAAGGTCACAAATCCAAAGTGGG - Intergenic
1043294216 8:78644476-78644498 CAGGGTCACCACTTGCAGGTTGG - Intergenic
1046106653 8:109674044-109674066 CAGGTACACCAATCAAAAGTAGG - Intronic
1046157802 8:110316355-110316377 CACAGTCAACAATTTAAGGTAGG - Intergenic
1049462494 8:142736578-142736600 CAGAGTCACCAAGGCAAAGTTGG + Exonic
1052864007 9:33454041-33454063 CCAGGTCACCCATTTAAAGATGG - Intergenic
1056525070 9:87435545-87435567 TAGGGTGAACAATTTAGAGTTGG - Intergenic
1060234102 9:121850293-121850315 TAGGGTCTCCACTTTAAAGATGG - Intronic
1061574822 9:131499610-131499632 CAGGGCCACCAATGTGTAGTTGG + Exonic
1186076970 X:5891193-5891215 CTAGGTCACCAATTTAAAATGGG + Exonic
1187619876 X:21040323-21040345 CATGGTCATAAATTTAAAATGGG - Intergenic
1188129859 X:26418390-26418412 CAGGTACACCAATTAAATGTAGG + Intergenic
1188340219 X:28990930-28990952 TAGGGACAACAATTTAAATTTGG + Intronic
1192198465 X:69048132-69048154 CATAGACACCATTTTAAAGTTGG - Intergenic
1197098179 X:122620471-122620493 CAGGTACACCAATTAAATGTAGG + Intergenic
1199423015 X:147668050-147668072 GAGGTTCAAAAATTTAAAGTTGG + Intergenic
1199739027 X:150715150-150715172 CAGGGTCACCAAAGGAGAGTGGG - Intronic