ID: 930102496

View in Genome Browser
Species Human (GRCh38)
Location 2:47614175-47614197
Sequence CTGTGTTAGTGGCCAGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930102496_930102499 -1 Left 930102496 2:47614175-47614197 CCTGCAACTGGCCACTAACACAG No data
Right 930102499 2:47614197-47614219 GAATATAGAGAGCTGGCTTATGG No data
930102496_930102498 -8 Left 930102496 2:47614175-47614197 CCTGCAACTGGCCACTAACACAG No data
Right 930102498 2:47614190-47614212 TAACACAGAATATAGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930102496 Original CRISPR CTGTGTTAGTGGCCAGTTGC AGG (reversed) Intergenic
No off target data available for this crispr