ID: 930104845

View in Genome Browser
Species Human (GRCh38)
Location 2:47631701-47631723
Sequence TTAAACACCCAGACATGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930104845_930104847 -4 Left 930104845 2:47631701-47631723 CCTGGACATGTCTGGGTGTTTAA No data
Right 930104847 2:47631720-47631742 TTAAAGATGCTTGGTGCTTCTGG No data
930104845_930104848 1 Left 930104845 2:47631701-47631723 CCTGGACATGTCTGGGTGTTTAA No data
Right 930104848 2:47631725-47631747 GATGCTTGGTGCTTCTGGTGTGG No data
930104845_930104849 9 Left 930104845 2:47631701-47631723 CCTGGACATGTCTGGGTGTTTAA No data
Right 930104849 2:47631733-47631755 GTGCTTCTGGTGTGGATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930104845 Original CRISPR TTAAACACCCAGACATGTCC AGG (reversed) Intergenic
No off target data available for this crispr