ID: 930105265

View in Genome Browser
Species Human (GRCh38)
Location 2:47634256-47634278
Sequence TTAGGTTGCTAGTTGATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930105265_930105270 16 Left 930105265 2:47634256-47634278 CCCAGGATCAACTAGCAACCTAA No data
Right 930105270 2:47634295-47634317 TAATGCTTCTCCCTGTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930105265 Original CRISPR TTAGGTTGCTAGTTGATCCT GGG (reversed) Intergenic
No off target data available for this crispr