ID: 930112781

View in Genome Browser
Species Human (GRCh38)
Location 2:47693279-47693301
Sequence CTAAGCTGGACTAAAACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38437
Summary {0: 1, 1: 3, 2: 192, 3: 4182, 4: 34059}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930112781 Original CRISPR CTAAGCTGGACTAAAACTCC TGG Intergenic
Too many off-targets to display for this crispr