ID: 930113914

View in Genome Browser
Species Human (GRCh38)
Location 2:47702432-47702454
Sequence GCATTTTGGTCTGCTACAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930113914_930113917 -1 Left 930113914 2:47702432-47702454 CCTGTTGTAGCAGACCAAAATGC 0: 1
1: 0
2: 0
3: 10
4: 121
Right 930113917 2:47702454-47702476 CCACCCCAAAACATGACTGTAGG 0: 3
1: 17
2: 32
3: 56
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930113914 Original CRISPR GCATTTTGGTCTGCTACAAC AGG (reversed) Intronic
911412548 1:97527950-97527972 TCATTGTGATATGCTACAACGGG + Intronic
913336052 1:117709827-117709849 GCATTTTTGTTTGCTAAATCTGG + Intergenic
913462529 1:119103029-119103051 ACTTTTTTTTCTGCTACAACAGG + Intronic
916762706 1:167831711-167831733 GTATTTTCATCTGCTAAAACAGG - Intronic
921066767 1:211628764-211628786 GCATTTTGATTTGCTAAATCTGG - Intergenic
922177886 1:223211211-223211233 GCATTTTGGGTTGTCACAACCGG - Intergenic
922771965 1:228190279-228190301 TCATTTTGCTCTGATACAACAGG + Intergenic
924055411 1:240119510-240119532 ACATTTTGGGCTGTTACAGCTGG + Intronic
1063187502 10:3664537-3664559 GCATTTTTGTCTGCTACTCTGGG + Intergenic
1074974129 10:118566690-118566712 GCATCTTGGTCTCCTTCAGCTGG - Intergenic
1087821890 11:102721851-102721873 GCATCATGGTGTGCTACCACTGG + Intronic
1090920963 11:131205490-131205512 GCATTTTTGGTTGCTACATCTGG - Intergenic
1092105280 12:5917416-5917438 GCATTTTTGTTTGCTAAACCTGG + Intronic
1093038971 12:14357979-14358001 CCATTTTGTGCTGCTATAACAGG + Intergenic
1093398593 12:18714729-18714751 ACATTTTCGGCTGCCACAACTGG + Intronic
1094178093 12:27562692-27562714 GCTTTTTAGACTGCTAAAACTGG + Intronic
1096496081 12:52040225-52040247 GCATTTTGATCTGGAACAAGTGG + Intronic
1099426487 12:82530212-82530234 ACATTTTTGTTTGCCACAACTGG - Intergenic
1100120224 12:91360946-91360968 GCATTTTTCCCTGCTACCACAGG + Intergenic
1103141478 12:118552515-118552537 ACATTTTTGGTTGCTACAACTGG - Intergenic
1106371660 13:29140520-29140542 GCAACTTGGTTTCCTACAACAGG - Intronic
1108875129 13:55037959-55037981 GCATATTGGTATGCTGCAAAAGG + Intergenic
1111110773 13:83706446-83706468 TCATTTTCCTCTACTACAACTGG + Intergenic
1112704767 13:102055126-102055148 GGATTTTTGTATGCTACAAATGG - Intronic
1113016422 13:105833231-105833253 CCATTTTGGTCTTCTAAAAAGGG - Intergenic
1114905718 14:27123556-27123578 GCATTTTGGTGAGTTAAAACTGG - Intergenic
1115420348 14:33186865-33186887 CCATTTTTGGCTGCTACAACTGG + Intronic
1125342750 15:38690602-38690624 GCTTTTTGGTCTGCAATTACTGG - Intergenic
1125697391 15:41650915-41650937 CCATTTTGTTCTGCTATAACAGG + Intronic
1127003070 15:54532822-54532844 GGATTTTGATCTGTTTCAACTGG - Intronic
1127098942 15:55543990-55544012 GCATTTTAACCTGCTTCAACTGG + Exonic
1130804337 15:87302870-87302892 GCATTTTCGTCTTCTAAGACTGG + Intergenic
1133344104 16:5058760-5058782 GCATTTTGATTTGCTAAATCTGG + Intronic
1133378853 16:5313196-5313218 GCAATTTGCCCTGCTTCAACAGG - Intergenic
1135096529 16:19569125-19569147 GGATTTTGGTTTGCTACATAGGG + Intronic
1140742642 16:77955277-77955299 GCATTTTTGTTTGTCACAACGGG + Intronic
1142119660 16:88379686-88379708 TCACTTTGGACTGTTACAACTGG - Intergenic
1144952647 17:19002474-19002496 GCATTCTGGTCTTCTGCAATTGG + Intronic
1148537389 17:48451674-48451696 GAAATTTGATCTGCCACAACAGG + Intergenic
1150017135 17:61569356-61569378 GCATGTTTTTCTGTTACAACCGG - Intergenic
1150962881 17:69934278-69934300 ACATTTTGGGTTGTTACAACTGG - Intergenic
1153784410 18:8521908-8521930 GCATTATGATGTGCTAGAACTGG - Intergenic
1157344799 18:46817053-46817075 ACATTTTGTTCTGCTTCAAATGG + Intronic
1157972144 18:52283162-52283184 GCATTTTGGTCTGGTAACATTGG + Intergenic
1158373467 18:56834733-56834755 ACATTTTTGTCTGCTAAAAGTGG + Intronic
1158748830 18:60234970-60234992 TCATTTTGTGCTGCTATAACAGG + Intergenic
1159561249 18:69997388-69997410 ACATTTTGGCCTTTTACAACAGG + Intergenic
1160665979 19:328499-328521 GCATTTTGGAAGGCTACAGCAGG + Intronic
1162850347 19:13426390-13426412 CCATTTTTGGCTGCCACAACTGG + Intronic
1163300606 19:16443378-16443400 GCATATTGTTGTGCTACAAAGGG + Intronic
1165320244 19:35080524-35080546 GCCTCTTGGTCTCCTACGACTGG + Intergenic
1166819371 19:45568108-45568130 GCATTTTGGGAGGCTAAAACTGG - Intronic
1168531156 19:57130455-57130477 GCATTCTTGTCTGGTTCAACGGG - Exonic
930113914 2:47702432-47702454 GCATTTTGGTCTGCTACAACAGG - Intronic
931055177 2:58461469-58461491 GGATTTTGCTCTGCTTCAAAAGG - Intergenic
931780627 2:65576588-65576610 ACATTTTTGGTTGCTACAACTGG + Intergenic
933639343 2:84742442-84742464 ACATTTTTGTTTGCCACAACTGG + Intronic
933718099 2:85376797-85376819 GCTTTTTGGTCTGCTCCCATTGG + Intronic
935034665 2:99358060-99358082 GCATTTTAGAATGCTACATCTGG - Intronic
936411173 2:112259638-112259660 ACATTTTGGGTTGCCACAACTGG - Intergenic
940845346 2:158635322-158635344 GCATTTGGTTCTGCTACTCCTGG + Intronic
940963473 2:159811870-159811892 GCATTTTGATCTGCAGCAGCTGG - Intronic
943234085 2:185295183-185295205 ACATTATGGTCTGAGACAACAGG - Intergenic
945253247 2:207782377-207782399 GCACTTTGGCCTGCTGCAGCAGG - Intergenic
947143169 2:227038700-227038722 GCTGTTTGCTCTGCTAGAACAGG - Intronic
1169980157 20:11375799-11375821 GGATTTTGGTCAGCTCCAGCTGG + Intergenic
1172104361 20:32507498-32507520 GCATATTAATCTGATACAACTGG + Intronic
1177507735 21:22040213-22040235 GCATGCTGGTCAGCTACAGCAGG + Intergenic
1184007132 22:41718654-41718676 GCATTTTATGCTGCTATAACAGG + Intronic
955744006 3:62121873-62121895 CCATTTTGTTCTGCTACAAATGG + Intronic
958132243 3:89442484-89442506 GCATTTTTGGCTGTCACAACTGG + Intronic
958589143 3:96132033-96132055 GCATTTTGGAATGTTGCAACTGG - Intergenic
959354677 3:105310641-105310663 GGATTTTGGGCTGAGACAACAGG - Intergenic
960427116 3:117522432-117522454 GCATTTGATTCTGCTACAGCAGG - Intergenic
961111226 3:124284986-124285008 GCATGTTGCTCTGTTACAACTGG - Intronic
962533928 3:136309983-136310005 ACATTTTGGGATGCTAAAACGGG + Intronic
963941176 3:151097681-151097703 ACATTTTGGGTTGCCACAACTGG + Intronic
970681652 4:18515480-18515502 GCATATTGGTATGCTACAAAAGG + Intergenic
971448254 4:26775712-26775734 CCATGTTGTTCTGCTATAACAGG - Intergenic
971764678 4:30815236-30815258 CCATATGGGTCTGCAACAACTGG + Intronic
971920462 4:32932953-32932975 TCAGTTTGGGCTGCTATAACAGG + Intergenic
978150984 4:105434444-105434466 ACATTTTGGGTTGCCACAACTGG + Intronic
984137238 4:175956011-175956033 GCATGTTGGTATTTTACAACTGG - Intronic
989240776 5:39201355-39201377 GCATTTTTGATTGCCACAACTGG - Intronic
991200692 5:63988036-63988058 TCATTTTGGGCTGCTAAAAGAGG + Intergenic
991917858 5:71623199-71623221 ACAATTTGTTCTGCTACAATAGG - Intronic
992728245 5:79631164-79631186 GCATTTTGGGCTGTCACAACTGG - Intronic
998264093 5:140654031-140654053 GGATTTTGCTCTGCTTCAAAAGG + Exonic
1001221917 5:169907805-169907827 ACATTTTTGTTTGCCACAACTGG + Intronic
1002783688 6:385432-385454 GCATTTTTATTTGCTAAAACTGG + Intergenic
1004153061 6:13139192-13139214 TCCTTTGGGTCTTCTACAACAGG + Intronic
1005394342 6:25365795-25365817 GCATTTTGGAATGCCAAAACAGG - Intronic
1007405468 6:41633561-41633583 GCATTTTGGTAGGCTAAGACAGG + Intergenic
1009247350 6:61255265-61255287 GCACTTTGGTAGGCTACAGCAGG - Intergenic
1009287480 6:61839059-61839081 GCACTTCCCTCTGCTACAACTGG + Intronic
1010072754 6:71763291-71763313 TCATTTTGGGCTGCTGTAACAGG + Intergenic
1011067979 6:83349602-83349624 GCATTTAGGTAGGCTACAAGAGG - Intronic
1015714651 6:136180146-136180168 GCACTTTGGACAGCTACAAAGGG - Intronic
1016554420 6:145319570-145319592 GCATTTAGATCTGCTCCACCAGG - Intergenic
1018741048 6:166728865-166728887 TCATTTTAGTGTGCTAAAACTGG + Intronic
1020930752 7:14390261-14390283 GCATGTTGGTTTGCTACATCAGG - Intronic
1021982839 7:26071450-26071472 ACATTTTTAGCTGCTACAACTGG + Intergenic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1030167618 7:106570888-106570910 GCATTTTAGTCTGGCACATCTGG - Intergenic
1031440427 7:121788054-121788076 GCATTTGGGGTTGGTACAACAGG + Intergenic
1035200871 7:157264816-157264838 GCATTTTGGGAGGCCACAACGGG - Intronic
1038191747 8:25328078-25328100 GCATTCTGGTCTTCTGCAGCTGG + Intronic
1040016636 8:42705662-42705684 TTATTTTGTGCTGCTACAACAGG - Intronic
1042542544 8:69921772-69921794 GCATTTTTGGCTTCAACAACTGG - Intergenic
1043716676 8:83495645-83495667 AGATTTTGGGCTGATACAACGGG + Intergenic
1045402795 8:101835388-101835410 ACATTTTAGACTGTTACAACAGG + Intronic
1046126877 8:109920986-109921008 GCATTTTTGATTGCCACAACTGG - Intergenic
1047824976 8:128563415-128563437 GCATTTTTGTTTGCCACAATTGG - Intergenic
1049409667 8:142466829-142466851 GCATCTTGGTCTGCCACTCCTGG + Intronic
1050686669 9:8178225-8178247 GCATTTTGGATTGTCACAACTGG + Intergenic
1055025510 9:71715489-71715511 GCATTTTGGGAGGCTAAAACAGG - Intronic
1055362771 9:75512147-75512169 GCATTTTAGTGTTCTAGAACAGG - Intergenic
1186738525 X:12492811-12492833 GTATTTTGATCTCATACAACAGG - Intronic
1186907480 X:14127204-14127226 ACATTTTGGGCTGTCACAACCGG - Intergenic
1188240275 X:27778581-27778603 GCATCTTGGTGTACCACAACGGG - Intergenic
1188537301 X:31211775-31211797 GCAGTGTGCTCTGCTAAAACTGG + Intronic
1189893881 X:45633382-45633404 GCATCTTGGTCTGCTGCTCCAGG + Intergenic
1190804688 X:53824284-53824306 GCTTTATTCTCTGCTACAACAGG - Intergenic
1191853249 X:65601730-65601752 ACACTTTGGGCTGCAACAACAGG + Intronic
1192062051 X:67838120-67838142 GTATTATTTTCTGCTACAACAGG - Intergenic
1194533368 X:95077336-95077358 CCATTTTGGTCTTTTATAACAGG - Intergenic
1195617702 X:106926164-106926186 GGATTTTGGTCTGGCACAAGTGG + Intronic
1195732165 X:107978931-107978953 GCATTTTTGGTTGTTACAACTGG + Intergenic
1196365077 X:114914837-114914859 TCATTTTGTGCTGCTATAACAGG + Intergenic
1197153417 X:123244677-123244699 GCATTTTGGGTTGTCACAACAGG + Intronic
1197372097 X:125638153-125638175 TCATTTGGGTGTGCTACAACAGG - Intergenic
1199032140 X:143013257-143013279 GGATTTTGTTCTGCTACAATAGG - Intergenic