ID: 930116782

View in Genome Browser
Species Human (GRCh38)
Location 2:47724969-47724991
Sequence TTGCAGGAATAGTGGGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930116774_930116782 20 Left 930116774 2:47724926-47724948 CCTGGAAAAAGAAGGCGTTACCC 0: 1
1: 0
2: 0
3: 9
4: 71
Right 930116782 2:47724969-47724991 TTGCAGGAATAGTGGGAGATAGG 0: 1
1: 0
2: 1
3: 12
4: 224
930116776_930116782 0 Left 930116776 2:47724946-47724968 CCCAAAGGAACCAGAAGAATAGA 0: 1
1: 0
2: 8
3: 119
4: 1021
Right 930116782 2:47724969-47724991 TTGCAGGAATAGTGGGAGATAGG 0: 1
1: 0
2: 1
3: 12
4: 224
930116779_930116782 -10 Left 930116779 2:47724956-47724978 CCAGAAGAATAGATTGCAGGAAT 0: 1
1: 0
2: 0
3: 29
4: 293
Right 930116782 2:47724969-47724991 TTGCAGGAATAGTGGGAGATAGG 0: 1
1: 0
2: 1
3: 12
4: 224
930116773_930116782 23 Left 930116773 2:47724923-47724945 CCACCTGGAAAAAGAAGGCGTTA 0: 1
1: 0
2: 0
3: 7
4: 107
Right 930116782 2:47724969-47724991 TTGCAGGAATAGTGGGAGATAGG 0: 1
1: 0
2: 1
3: 12
4: 224
930116777_930116782 -1 Left 930116777 2:47724947-47724969 CCAAAGGAACCAGAAGAATAGAT 0: 1
1: 0
2: 0
3: 34
4: 391
Right 930116782 2:47724969-47724991 TTGCAGGAATAGTGGGAGATAGG 0: 1
1: 0
2: 1
3: 12
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930116782 Original CRISPR TTGCAGGAATAGTGGGAGAT AGG Intronic
900947381 1:5838722-5838744 TTCCAGGACTAGGGGGAGACTGG + Intergenic
902090443 1:13898683-13898705 TTGCATGATTAGTGAGGGATTGG + Intergenic
906812446 1:48842209-48842231 TTGCTGGAATGATGGGAAATGGG - Intronic
908833336 1:68203722-68203744 TTGCAGGCATAGTGAGAGACAGG + Intronic
910048828 1:82953000-82953022 TGGGGGGAATAGTGGGAGAGGGG - Intergenic
910120505 1:83783921-83783943 AGGCATGAATAGTGGGAGGTGGG - Intergenic
910340809 1:86184802-86184824 TTGCAGGAATGGTGGGGGATGGG - Intergenic
913387433 1:118274459-118274481 TTGAAGAAATAGTGATAGATTGG - Intergenic
913606181 1:120468639-120468661 ATGCAGAATTACTGGGAGATGGG - Intergenic
917076548 1:171212142-171212164 TTGCAATAGTATTGGGAGATGGG + Intergenic
917782306 1:178411394-178411416 TGGGAGGAAGGGTGGGAGATGGG + Intronic
918012402 1:180600105-180600127 TTGGAAGTATAGTGGGAGAGGGG - Intergenic
918694758 1:187531557-187531579 TTGAAGGATTACTGAGAGATTGG + Intergenic
920591382 1:207222078-207222100 TTGCAAGAGAAGTGGGAGGTAGG - Intergenic
920654933 1:207868162-207868184 GGCCAGGAATGGTGGGAGATGGG - Intergenic
920677492 1:208048352-208048374 TTTCAGGAATGGTAGGAGAGAGG - Intronic
922687011 1:227647885-227647907 TTGCAAGAGTAGTGGTATATTGG + Intronic
1063173135 10:3527769-3527791 TTGCAAAAATGGTGGGAGAAAGG - Intergenic
1064852170 10:19720938-19720960 TTGCAGTAATCATGAGAGATTGG - Intronic
1064924411 10:20554334-20554356 TTGCAGGATGAGTGGGTGAAAGG + Intergenic
1066048959 10:31618179-31618201 CTGCAGGAAGGGTGGGAGGTGGG - Intergenic
1069295104 10:66834127-66834149 AGGCAGGAAAAGTGGGGGATTGG - Intronic
1069347837 10:67490581-67490603 GTGGAGGGATGGTGGGAGATGGG + Intronic
1069940545 10:71952360-71952382 GTGTAGGAATAGGGGGAGAGCGG + Intergenic
1071484696 10:86091250-86091272 TTCCAGGCAGAGTGCGAGATGGG - Intronic
1072465408 10:95657769-95657791 ATGCAAGAATATTGGGAGGTGGG + Intergenic
1073326871 10:102648236-102648258 TTGAAGGACTGGTGGGAGCTGGG + Intronic
1074786581 10:116847532-116847554 TTTCAGGAATAATGAGAAATAGG - Intergenic
1075599646 10:123758076-123758098 TTTCAGGCATACTGGGAGAGTGG - Intronic
1076765182 10:132629480-132629502 TTGCATGCATAGCGGAAGATTGG + Intronic
1077325263 11:1961025-1961047 TTGCAGGAAAGGTGGGAGGTGGG - Intronic
1080249816 11:30220258-30220280 TTTCAGGAACTGTAGGAGATAGG - Intergenic
1080390515 11:31841815-31841837 ATGCATCTATAGTGGGAGATAGG + Intronic
1080400013 11:31925623-31925645 TTGCTGGAATAATGGGAAAGAGG - Intronic
1080911886 11:36609172-36609194 TTCCTGCAGTAGTGGGAGATGGG + Intronic
1081239159 11:40681940-40681962 TTGGGGGAAGAGTGGGAGGTGGG + Intronic
1081975221 11:47229519-47229541 TGGCAGCAATAGTGGAAGACTGG + Intronic
1082972931 11:59042815-59042837 GTGAAGGAACAGTGGGAGGTTGG + Intronic
1082977335 11:59086385-59086407 GTGAAGGAACAGTGGGAGGTTGG + Intergenic
1083200825 11:61119995-61120017 TTGCAGCAATGGTGAGAGGTGGG + Intronic
1083543772 11:63534132-63534154 TTGCAGCAAGAGAGAGAGATGGG + Intergenic
1084119346 11:67059867-67059889 GTGCAGGAAGTCTGGGAGATGGG - Intronic
1084692043 11:70733200-70733222 TTGCAGGATGAGTAGGAGTTGGG + Intronic
1085210847 11:74776893-74776915 TTGAAGGAATAGTAGAAGATTGG + Intronic
1085565025 11:77505948-77505970 TTGAGGGATTAGTGGGAGCTGGG + Intergenic
1085956605 11:81405383-81405405 ATGCAGCAATACTGGGAGATGGG + Intergenic
1087361498 11:97166155-97166177 TTGAAGCAATAATGGGAGTTGGG + Intergenic
1087556572 11:99729209-99729231 TTGGGGGAAAAGTGGGTGATGGG + Intronic
1087615797 11:100485896-100485918 TTGTAGGAAAAATGGCAGATAGG + Intergenic
1087743056 11:101911802-101911824 TTGCTGGAATAGAGTGAGGTAGG - Intronic
1088421824 11:109656948-109656970 TGGCAGGAATTGGGGTAGATGGG + Intergenic
1088763785 11:112957563-112957585 TTGAAGGAGTAGTGGGATAATGG - Intergenic
1090142738 11:124282253-124282275 TGGCAGGAAGGGTGGGAGAGGGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1202808244 11_KI270721v1_random:16204-16226 TTGCAGGAAAGGTGGGAGGTGGG - Intergenic
1093557003 12:20488220-20488242 TTGGAGGCATAAGGGGAGATTGG - Intronic
1093934058 12:24982605-24982627 GTGCAGCAATATTGGGAGATGGG - Intergenic
1095892732 12:47249886-47249908 TTCCAGGAAGAGGGAGAGATAGG - Intergenic
1097313951 12:58152260-58152282 TTGCAGAATCAGTGGCAGATAGG - Intergenic
1097610249 12:61810906-61810928 TGGCAGGAATGGTGGTAGGTTGG - Intronic
1098669442 12:73207201-73207223 TGGCAGGAATAGTGGTGGGTGGG + Intergenic
1099540132 12:83897763-83897785 TTTCAGCAATGGAGGGAGATGGG + Intergenic
1100691809 12:97046409-97046431 ATGGTGGAATGGTGGGAGATGGG - Intergenic
1102709443 12:114913160-114913182 CAGCAGGAATAGGGGAAGATGGG + Intergenic
1105056338 12:133102845-133102867 ATGGAGGTATAGTAGGAGATGGG + Intronic
1107645622 13:42491767-42491789 ATGCAAGAATATTGGGAGGTGGG - Intergenic
1110666431 13:78122829-78122851 TTGCAGACAAAGTGGGAGAGAGG + Intergenic
1112310032 13:98310025-98310047 TTGGAGGAATAGAGAGAGAGAGG - Intronic
1112620394 13:101048333-101048355 TTGCAGGGATAGGAGGGGATAGG + Intergenic
1112737936 13:102442622-102442644 TTGCAGGGATCGTGGCGGATGGG + Intergenic
1116010112 14:39341482-39341504 TTGCAGAAATTGTGGTAGCTGGG + Intronic
1116364340 14:44040966-44040988 TTGCAGGAATAGAGGAGGCTTGG + Intergenic
1118297889 14:64587071-64587093 TTTCAGGAATATTGGGAAATTGG + Intronic
1118505078 14:66402421-66402443 TCCCAGGGATAGTGGGAGAAGGG - Intergenic
1119563102 14:75606519-75606541 AGGCAGGAATGGTGGGAGAGAGG - Intronic
1120847221 14:89137496-89137518 TTGCAGGAGTATTGGGTGAGGGG - Intronic
1122464501 14:101921757-101921779 TTGAAGGAATAGCTGGAGAGTGG + Intronic
1124814376 15:32974218-32974240 TAGCAGGAAGAGTGAGAGAGGGG - Intronic
1127372933 15:58357183-58357205 TTGCAGGAGTACTGTGATATTGG - Intronic
1127473794 15:59313639-59313661 TGGCAGGAATGGTGGAAGTTGGG - Intronic
1129550732 15:76445987-76446009 TTGTAGAAATAGTGGTAGAAGGG + Intronic
1131725969 15:95225133-95225155 TTGCAGTAGGAGTGAGAGATTGG - Intergenic
1131792215 15:95977639-95977661 TTGTAGCAATACTAGGAGATTGG + Intergenic
1132556949 16:576731-576753 ATGCAGGGAAGGTGGGAGATGGG - Intronic
1133502452 16:6378864-6378886 TTGCAGGGATGGTGAGAGGTGGG + Intronic
1134069402 16:11251477-11251499 TTGCTTAAATAGTGGGAGAGGGG - Intronic
1136085040 16:27878818-27878840 TTGCAGTAGTAGGGAGAGATTGG + Intronic
1140763635 16:78135077-78135099 TTACAGGAATGGTGGGAGTCAGG - Intronic
1141057746 16:80834315-80834337 TTGTAACAATGGTGGGAGATGGG - Intergenic
1141485963 16:84340583-84340605 TTCCTGGAAGAGTGGGAGAACGG - Intergenic
1144243418 17:13336532-13336554 TTGCAGGAAGAGTGGGATCCTGG - Intergenic
1145078276 17:19873392-19873414 TGGATAGAATAGTGGGAGATGGG + Intergenic
1146583348 17:34059606-34059628 TTGCAGGAGGAGGGTGAGATGGG - Intronic
1148838597 17:50479802-50479824 TTGGAGGAGTGGTGGGGGATAGG + Intronic
1151251345 17:72837985-72838007 ATTCAGGAATAGTGGTAGGTTGG + Intronic
1156520838 18:37721221-37721243 TTGGTGGATTAGTGGGAGAAAGG + Intergenic
1156850619 18:41721529-41721551 TTGCAGGCTCAGTGGGAGAGTGG + Intergenic
1157088597 18:44608287-44608309 TTGAAGGGATAGTGGAAGACAGG + Intergenic
1157505473 18:48223161-48223183 CTGCAGAGGTAGTGGGAGATGGG + Intronic
1161663797 19:5562986-5563008 CTGCAGGAAGAGAGGGAGTTGGG + Intergenic
1162888237 19:13712494-13712516 TTGCAGGTATCGTTGGAAATGGG - Intergenic
1164962642 19:32447959-32447981 TCTCAGGAAGAGTGGGAGGTGGG + Intronic
1165327718 19:35123940-35123962 TTCCAGGAAAACTGGGACATAGG + Intronic
1165419486 19:35715915-35715937 TGGAAGGAACAGTGGGAGGTAGG - Intronic
1166239895 19:41483141-41483163 TTGTAGAAATAGTGAGAAATAGG - Intergenic
1166299261 19:41904926-41904948 CTGCAGGGAGAGGGGGAGATGGG - Intronic
1166546496 19:43637230-43637252 CAGCAGGAATCGGGGGAGATGGG - Intronic
1166740067 19:45109226-45109248 TTGCAGGAAAGGTGGGGGACAGG + Intronic
926534545 2:14094308-14094330 ATGCACAAATAGTGTGAGATAGG - Intergenic
927226599 2:20771955-20771977 TTGCAGGAATAGTGGTGAAAAGG - Intronic
927762450 2:25771490-25771512 CTGCTGGAATGGTGGGTGATGGG + Exonic
928826719 2:35430987-35431009 TGGCAAGAATATGGGGAGATTGG - Intergenic
930116782 2:47724969-47724991 TTGCAGGAATAGTGGGAGATAGG + Intronic
930568649 2:53056081-53056103 TTGCAGGAATAGTAATAGAAAGG - Intergenic
932263269 2:70344670-70344692 ATGGAGAAATAGTGGGAGAGAGG + Intergenic
932699261 2:73982274-73982296 TTGCAGGATGAGTGGGAATTTGG + Intergenic
933500134 2:83101215-83101237 CTGCAGGAAGAGTGTTAGATAGG + Intergenic
934157311 2:89215287-89215309 TGACAGGGACAGTGGGAGATTGG + Intergenic
934210004 2:89967456-89967478 TGACAGGGACAGTGGGAGATTGG - Intergenic
934689519 2:96347604-96347626 TTTGAGGAGGAGTGGGAGATGGG + Intronic
934989064 2:98908577-98908599 TTGCAGCAATAGAGTGAGTTTGG - Intronic
935173414 2:100628226-100628248 CTGCAGGAAGAGTGAAAGATGGG + Intergenic
935408244 2:102732314-102732336 TTGCTGGAATAGTAGGTGAGTGG - Exonic
937803411 2:126107789-126107811 TTGGAAGAATATTGGAAGATAGG + Intergenic
939737858 2:145871929-145871951 TAGCAGGAAAACTGGGAGACTGG + Intergenic
940391600 2:153138935-153138957 TTCCAGGAAAAGTGGTAAATTGG - Intergenic
945696564 2:213113941-213113963 TTGCAGTTGCAGTGGGAGATAGG - Intronic
945780545 2:214166372-214166394 GGGCAGGAAGAGAGGGAGATTGG + Intronic
946306010 2:218857472-218857494 TTGCAGGAAAGGTGGGGGGTGGG + Intergenic
948518100 2:238518964-238518986 TTGCAGGAATAGTTCCTGATAGG - Intergenic
948751820 2:240137487-240137509 TTGGAGGAAGAGAGGGAGAGAGG + Intergenic
1169159160 20:3361474-3361496 TTGCAGGGAAAGTGGGAGGTGGG + Intronic
1171234097 20:23510268-23510290 TTGCAGGAATAGGTGCACATGGG + Intergenic
1174213737 20:48900193-48900215 CTGCAGGAATAATGGGAAAAGGG - Intergenic
1174881294 20:54282107-54282129 TTGCTGCCATAGTGGGAGGTGGG - Intergenic
1175841699 20:62032039-62032061 CTTCAGGAAGAGTGCGAGATGGG - Intronic
1177423383 21:20891232-20891254 TAGCAGGAAAAGTGGGGTATAGG + Intergenic
1182520107 22:30880386-30880408 GTGCAGGGATAATGGGAGAAAGG - Intronic
951783649 3:26393151-26393173 TTGCAGGCAAATTGGGAGTTTGG + Intergenic
952237493 3:31495138-31495160 TTCCAGGAAAAGTGTGAGATAGG - Intergenic
952435553 3:33269498-33269520 TTGCAGCCACTGTGGGAGATGGG + Intergenic
953127043 3:40101196-40101218 TTGCAGATATACTGGGAGAATGG - Intronic
953236483 3:41111943-41111965 GCCCAGGAATATTGGGAGATGGG - Intergenic
953446826 3:42975593-42975615 TTGCAGGAATCCAGGGAGTTAGG + Intronic
954639021 3:52087080-52087102 TTGAAGGGATAGAGGGAGAGTGG + Intronic
955552462 3:60099082-60099104 TTTTAGGCACAGTGGGAGATGGG - Intronic
957314475 3:78559694-78559716 ATGCAGGAGTGTTGGGAGATGGG + Intergenic
957458975 3:80492712-80492734 TAGTAAGAATAGTGGGAGATGGG + Intergenic
961136385 3:124515278-124515300 GTACATGAATAGGGGGAGATAGG + Intronic
961248864 3:125482297-125482319 TTTGAGGAGTAGTGGAAGATAGG - Intronic
961620074 3:128217199-128217221 TTACAGCAATAGGGCGAGATAGG + Intronic
965519969 3:169662145-169662167 TTGCTGTAAGAGTGGGGGATGGG + Intronic
965872472 3:173278427-173278449 TTGTAGGTATAGAGGGAGAAAGG - Intergenic
967242966 3:187459185-187459207 TTGCAGAAATAATAGGAGAGTGG - Intergenic
967605199 3:191436684-191436706 ATAGAGTAATAGTGGGAGATGGG - Intergenic
967920332 3:194609563-194609585 TTGGTGGAATAGTGGGACATGGG + Intronic
969910710 4:10442960-10442982 CTGTAGGAATATTGGGAGCTAGG - Exonic
975079775 4:70262493-70262515 TTGAAGGAATAGTGATAGCTTGG - Intergenic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
978885795 4:113764632-113764654 TTGCAGGAGGAGAGAGAGATTGG + Intergenic
981626417 4:146761089-146761111 TTGGGGGAAGAGTGGGAGTTGGG + Intronic
981678448 4:147366234-147366256 AGGCAGGAATAGTGGGAGCCAGG + Intergenic
983566951 4:169163436-169163458 TTGCAGGAAAAGTGGGCTAAGGG + Intronic
984133995 4:175913569-175913591 GTGGATGAGTAGTGGGAGATGGG - Intronic
984896858 4:184548834-184548856 TTGCAGGATGAGTAGGTGATGGG - Intergenic
985269159 4:188177909-188177931 TTGCAGCAATGATGGGAGCTAGG - Intergenic
986255354 5:6098415-6098437 ATGCAGTAGTATTGGGAGATGGG - Intergenic
987370036 5:17184788-17184810 TGGCAGGAGTGGTGGGAGACGGG - Intronic
988362128 5:30250163-30250185 TTGAAGGAATACTGGGGGAAAGG - Intergenic
990817878 5:59805986-59806008 AGGGAGGAATAGTGGGAGAGGGG - Intronic
991536882 5:67679016-67679038 TTGCAGGCATAATGTCAGATGGG - Intergenic
994111143 5:96006194-96006216 ATGAAGGACTAGTTGGAGATGGG + Intergenic
994384051 5:99107316-99107338 TTGTAAGAATACTGAGAGATGGG + Intergenic
994887322 5:105581825-105581847 TTGAAGGAAAAATGGCAGATAGG + Intergenic
995773429 5:115698213-115698235 AAGCAGGCAGAGTGGGAGATTGG + Intergenic
996295387 5:121908843-121908865 TTTCAGGAAGAGTGGGAGGGAGG + Intergenic
996525342 5:124473428-124473450 TTTCGGGAAGAGTCGGAGATGGG - Intergenic
998188151 5:139998815-139998837 TTATAGGAATAGGGGAAGATAGG + Intronic
999051504 5:148528742-148528764 TTGCAGGAATAGTTCATGATAGG - Intronic
1000094611 5:157960355-157960377 TAGCAGAGATAGTGGGGGATGGG - Intergenic
1000681458 5:164189997-164190019 TGGCATGAAGAGTGGGAGAGTGG - Intergenic
1001629164 5:173161723-173161745 TTGCAGGAGTAGTTGCAGTTGGG + Intronic
1003598254 6:7494237-7494259 TTGCAGGTGCAGTGGGAGGTTGG - Intergenic
1004187147 6:13430665-13430687 TGGCAGGAGTAGTGGGACAGCGG + Intronic
1005051284 6:21686227-21686249 TTCCACGAACAGTGGGAGGTGGG - Intergenic
1006627275 6:35406280-35406302 TTGCAGGAATTGTGGTGGGTGGG + Intronic
1006845261 6:37057121-37057143 AGGCAGGAAGAGTGTGAGATGGG + Intergenic
1007311550 6:40950330-40950352 TAGCACAAATACTGGGAGATGGG + Intergenic
1009046717 6:58243460-58243482 TTGCTGCAATATTGGGAGTTAGG - Intergenic
1009222527 6:60997773-60997795 TTGCTGCAATATTGGGAGTTAGG - Intergenic
1010036610 6:71332454-71332476 TGGCAGGTGTTGTGGGAGATAGG + Intergenic
1010385895 6:75279162-75279184 CTCTGGGAATAGTGGGAGATAGG - Intronic
1011778721 6:90762213-90762235 TTGCAGGAACAGAAGGAAATGGG + Intergenic
1012316701 6:97790223-97790245 TTGGAGAAATAGTTGGAGAAAGG - Intergenic
1014666541 6:124244523-124244545 GAGCAGCAATAGTGGTAGATTGG - Intronic
1015356482 6:132282774-132282796 TTGCAGGAAGAGTATGAGAGAGG + Intergenic
1015367518 6:132413787-132413809 TTGGAGGAAGAGAGGGAGAGAGG - Intergenic
1019847378 7:3519138-3519160 TTGAAGGAAGAGTGGGGGATAGG + Intronic
1019882080 7:3870467-3870489 TTGAAGGAGCAGTGGGAGACAGG - Intronic
1022907107 7:34868081-34868103 CTGCAGGCACAGTGGGAGAGTGG + Intronic
1024875503 7:54018220-54018242 TTGCAGGAAGACAGGAAGATGGG + Intergenic
1025236455 7:57237922-57237944 TTGCAAGAAGAGTGAGAGAATGG - Intergenic
1027362630 7:77425267-77425289 TTTCAGGGAAAGTGGGAGCTGGG - Intergenic
1027558188 7:79692637-79692659 TAGCAAGAAGAGTGGGACATAGG - Intergenic
1028607299 7:92669018-92669040 TTGCTGGAAAAGTGAGACATTGG - Intronic
1030168485 7:106578230-106578252 TTACAGGAATACTAGGAGAAAGG + Intergenic
1030434775 7:109502537-109502559 TTGCTTGAGTAGTGGGAGGTGGG + Intergenic
1030858146 7:114587806-114587828 TTGCAGAACTAGTGTGAGAATGG - Intronic
1031265946 7:119580401-119580423 AGGGAGGAATAGTGAGAGATTGG + Intergenic
1031744958 7:125484156-125484178 TTGCAGGAATTTTTGGAGAGAGG - Intergenic
1032997963 7:137469511-137469533 TTGCGGGTATCGTGGGAGTTGGG - Intronic
1033516278 7:142109980-142110002 CTGCAGAAACAGGGGGAGATGGG + Intergenic
1036620795 8:10423571-10423593 GTGCAGGAGCAGGGGGAGATAGG - Intronic
1037007483 8:13799979-13800001 TTGAAGGGTTAGTGGGAGGTAGG - Intergenic
1037162754 8:15792913-15792935 TTGCAGAAATAGTAGGTGGTCGG - Intergenic
1038414318 8:27382723-27382745 TTTCATGTATAGTGAGAGATAGG + Intronic
1038730760 8:30125528-30125550 TTGGATGAATAGAGGCAGATTGG + Intronic
1039007871 8:33060716-33060738 TAGAAGGAAAAGTGGGAGAGCGG + Intergenic
1039560302 8:38507307-38507329 TTGCAGGATCTGTGGGAGACAGG + Intergenic
1043926947 8:86048101-86048123 TAGCAGGAATAGTTAGATATGGG - Intronic
1044501329 8:92962051-92962073 TTGCAACAATAGAGTGAGATAGG - Intronic
1044870472 8:96614878-96614900 GTTTAGGAATAGTGGGAGCTAGG - Intergenic
1046853347 8:119000863-119000885 TTGCAGGAAATGTGGTAGAGAGG + Intronic
1050802306 9:9630407-9630429 GTGTAGGAAAAGTGGGACATTGG - Intronic
1051676018 9:19558936-19558958 TTGCAGGGATGGTTGGAGAAGGG + Intronic
1054960276 9:70960575-70960597 TAGCAGGAATACTGGGAGGCAGG + Intronic
1062086659 9:134652657-134652679 CTGCAGGAATCGTGGGATAGAGG + Intronic
1062624013 9:137434903-137434925 TTGCAGGACTAGTGGGAAGGCGG - Exonic
1187714327 X:22087319-22087341 TGGAAGAAATAGTGGCAGATTGG + Intronic
1190069021 X:47264034-47264056 TTGGAGGAAAAGTGGGGGAAGGG - Intergenic
1190448882 X:50557869-50557891 TTCCAGGATGAGGGGGAGATGGG - Intergenic
1190652244 X:52578340-52578362 TTGCAGGACAAATGAGAGATGGG + Intergenic
1195501970 X:105612690-105612712 GTGCAGGAATTGTGAGACATTGG + Intronic
1195598102 X:106715989-106716011 GAGGAGGAGTAGTGGGAGATTGG - Intronic
1196054230 X:111338032-111338054 TTGAAGGATGAGTGGGATATAGG + Intronic
1198761217 X:140034485-140034507 TTGGAGGGATATTAGGAGATTGG - Intergenic
1199195502 X:145024837-145024859 TTGATGGAAAAGTGGCAGATAGG - Intergenic
1199689783 X:150299897-150299919 TTGCAGGAACAAAGGGGGATTGG + Intergenic