ID: 930118053

View in Genome Browser
Species Human (GRCh38)
Location 2:47736817-47736839
Sequence GTCCCACACCACCACACTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930118051_930118053 -1 Left 930118051 2:47736795-47736817 CCAGCTGAGTTCTGATTACCGTG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 930118053 2:47736817-47736839 GTCCCACACCACCACACTAAAGG 0: 1
1: 0
2: 0
3: 17
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930118053 Original CRISPR GTCCCACACCACCACACTAA AGG Intronic
906247255 1:44285035-44285057 GTCCCACCCCACCAAAGAAAGGG + Intronic
907635813 1:56133916-56133938 GGCCCACACCACCACATCACTGG + Intergenic
910419579 1:87043635-87043657 GTTCCAAACAACCACACTTAAGG - Intronic
911513184 1:98833415-98833437 GTTCCAGACCACCACAATAAAGG + Intergenic
913386883 1:118267401-118267423 TTCCCCCACCACCAGACCAAAGG - Intergenic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
917525696 1:175786514-175786536 TTCCCACAGCACCCCACTAGAGG + Intergenic
918031706 1:180819873-180819895 GGCACACACCACCACACCCAGGG - Intronic
919105910 1:193150407-193150429 GTTCAACACAACCACACTAAGGG - Intronic
920277526 1:204818303-204818325 GCTCCACACCACCACAATAAAGG - Intergenic
921276047 1:213521191-213521213 GGTCCAGACCACCACAATAAAGG + Intergenic
924428901 1:243979588-243979610 GTCCCACCCCCCCACACTCCTGG - Intergenic
1065322155 10:24519981-24520003 CTCCACCACCACCACACGAAAGG + Intronic
1066038502 10:31520300-31520322 GTCCCACACGACCACAGATACGG + Exonic
1067571913 10:47378029-47378051 GGCCCCCACCCCCACACTAAGGG + Intronic
1070676373 10:78414456-78414478 GTTCAACACCACCACAAGAAGGG - Intergenic
1074180419 10:111058052-111058074 GTCCTTCTCCACCACAATAATGG + Intergenic
1076598702 10:131643131-131643153 ATGCCACACCAGCACACTGAAGG + Intergenic
1077089750 11:773054-773076 GCCCCACTCCAACACACAAAGGG + Intronic
1077487124 11:2844148-2844170 GTCCCACCCCACCACTCTGCGGG - Intronic
1079027558 11:16961008-16961030 GTCCCCCTCCACCCCACTCAAGG + Intronic
1081256842 11:40906637-40906659 GTTCCAGACAACCACAATAAAGG - Intronic
1087083449 11:94194061-94194083 GTCCCTCACCCCAAAACTAAAGG - Intergenic
1089722812 11:120444726-120444748 TTCCCCCACCCCCAAACTAATGG - Intronic
1091776328 12:3187282-3187304 GCCCCACATCACAACACCAAAGG - Intronic
1093722627 12:22462533-22462555 CTCCCACACCACTACACACAGGG - Intronic
1095812555 12:46385503-46385525 GTGCCACACGAACACACAAAAGG - Intergenic
1096085910 12:48865071-48865093 CCCCCACACCACCACACCAGGGG + Intronic
1096496897 12:52043850-52043872 GTCCCAGACAACCGCACGAAGGG - Intronic
1097054157 12:56240015-56240037 GCCCCACAGCACCAAACAAAAGG + Exonic
1101182573 12:102235392-102235414 GCCCCACTCCACCACAGTGATGG + Intergenic
1101236438 12:102794692-102794714 GTCCCAAATCACCACCCCAAAGG + Intergenic
1102150614 12:110687328-110687350 GTCCCTGACCACCCCACTTAAGG - Intronic
1104352617 12:128057939-128057961 CTGCCACACCCCCAGACTAAAGG + Intergenic
1107525266 13:41224587-41224609 GTCCCAAAGCACCATATTAATGG + Intronic
1110373931 13:74770613-74770635 GTTCCAGATCACCACAATAAGGG + Intergenic
1111617493 13:90679362-90679384 GTTCCAGACCACCACAATAAAGG + Intergenic
1111910328 13:94303457-94303479 GTCTCTCACTTCCACACTAAAGG + Intronic
1117797377 14:59408466-59408488 GTCCCACACCCCCAGACCAAGGG + Intergenic
1121330067 14:93044175-93044197 GTCCCACACCACCAGCCTCATGG - Intronic
1122729331 14:103784029-103784051 GGCACCCACCGCCACACTAAAGG - Intronic
1124383192 15:29184929-29184951 GCCACACACCACCACACCCATGG - Intronic
1129293760 15:74588096-74588118 GGCACACACCACCACACTCAGGG - Intronic
1129518825 15:76172917-76172939 GCCGCACACCCTCACACTAATGG + Intronic
1133152091 16:3841791-3841813 GTCCCTGACCACCACAATTACGG + Intronic
1133744331 16:8675313-8675335 CTCTGACACCACCACATTAAAGG + Intronic
1135377290 16:21958840-21958862 GTTCCAGACCACCACAATGAAGG + Intronic
1135838795 16:25854750-25854772 CTCCCTTACCACCACACCAAGGG - Intronic
1137231827 16:46573782-46573804 GTCACCCACGACCACACTCAGGG + Intergenic
1137233938 16:46597083-46597105 GTTCCAAACCACCACAATAAAGG + Intronic
1137945182 16:52727082-52727104 TTCCCACACCATCCCCCTAAGGG + Intergenic
1140245288 16:73242833-73242855 ACCCCACACCTCCACACTGATGG - Intergenic
1147372704 17:40004398-40004420 GTTCCAGACCACCACGATAAAGG - Intergenic
1149147890 17:53519543-53519565 GTTCCAGACCACCACAATAAAGG + Intergenic
1151159166 17:72150515-72150537 TTCCAACACCACCACACTTGGGG - Intergenic
1159699700 18:71609585-71609607 TACCCACACCACCCCACTGAGGG + Intergenic
1168461731 19:56565384-56565406 GTACCTCACTGCCACACTAATGG - Intergenic
926213559 2:10889638-10889660 ATCTCCCACCACCACCCTAATGG - Intergenic
926796947 2:16627099-16627121 GTCCCACCCCACCCCATTCAGGG + Intronic
929237227 2:39618491-39618513 TTCGCAAACCACCATACTAATGG - Intergenic
930118053 2:47736817-47736839 GTCCCACACCACCACACTAAAGG + Intronic
931873067 2:66482300-66482322 GCCTCACACCACCACCCTTATGG + Intronic
932272875 2:70426004-70426026 GTCCCCCACCCCCAAACCAAAGG - Intergenic
934747633 2:96769985-96770007 TTCCCACAGCACTGCACTAAAGG - Intronic
946974809 2:225136626-225136648 GCCCCCCACCACCACTCTACAGG - Intergenic
1172325168 20:34028993-34029015 GACCCACACAGCCAGACTAATGG - Intronic
1174388459 20:50200999-50201021 GTCCCTCACCACCCCACAAGAGG - Intergenic
1176148404 20:63575694-63575716 GGCACACACCACCACAGTACAGG + Intergenic
1183391899 22:37550057-37550079 GTCCCACACCACCGTTCCAAAGG - Intergenic
951843663 3:27062380-27062402 GTCCCACACTTCCACAATGAAGG - Intergenic
956631298 3:71319250-71319272 CCCCCATACCACCACAATAAGGG + Intronic
957404980 3:79765674-79765696 TTCCCAAACAACCACAGTAAAGG + Intronic
959000630 3:100959832-100959854 GTCTCAAACTACCACACTAAAGG + Intronic
960241970 3:115354526-115354548 GTTCCAGACCACCACAATAAAGG + Intergenic
968322162 3:197779677-197779699 GGCACACACCACCACACCCAGGG + Intronic
968460736 4:723595-723617 GCCCCACACAACCAGACTGAAGG - Intronic
973128306 4:46616935-46616957 TTTCCAGACCACCACAATAAAGG - Intergenic
974843718 4:67325888-67325910 GTCCCCCACCCCTACACTGATGG - Intergenic
977568500 4:98606981-98607003 CTGCCACACCACCCCACTATGGG - Intronic
982247595 4:153369422-153369444 GTTCCATACCACCACAATAAAGG + Intronic
982438956 4:155411897-155411919 GTTTCAGACCACCACAATAAAGG + Intergenic
987303754 5:16618685-16618707 GTCCCCAATCCCCACACTAATGG - Intergenic
989625852 5:43428874-43428896 GCCCCACACCACCACCACAAAGG - Intergenic
992127789 5:73659691-73659713 GTTCCACATCACCACAATAAAGG + Intronic
994135126 5:96277901-96277923 GCCCACCACCACCACACTCATGG - Intergenic
998743294 5:145229154-145229176 GTCCCACAGCCCCACAAGAAAGG + Intergenic
999559337 5:152783306-152783328 ATCCCAAACCACCTCAATAAAGG + Intergenic
1000190326 5:158904096-158904118 GTGCCACACCACCAAAGCAAGGG + Intronic
1002802808 6:542185-542207 CTCCCACACCACCAAGCTGAAGG - Intronic
1003166867 6:3687112-3687134 CTCCCCCACCAGCAGACTAATGG - Intergenic
1004008323 6:11657303-11657325 GACCCACATCCCCTCACTAAAGG - Intergenic
1004259616 6:14096645-14096667 GTCCCAGACCTCCAGACTCAGGG - Intergenic
1006529592 6:34640015-34640037 TTCCCACTCCACCCCACCAAAGG - Intronic
1007287800 6:40760699-40760721 GTCCCACCCCATCCCACTAATGG - Intergenic
1007348985 6:41254752-41254774 GTCCCACACCCCAAAACAAAAGG - Intergenic
1018250371 6:161863785-161863807 GTTCCAGACCACCATAATAAAGG + Intronic
1018406011 6:163483035-163483057 GTTCCAGACCACCACAATAAGGG + Intronic
1019311096 7:361254-361276 GTCCCTCTCCACACCACTAAAGG - Intergenic
1019530496 7:1500612-1500634 GTCCCACACGACTACCCCAAAGG + Intronic
1021226965 7:18039239-18039261 GTCTCACACCACATCACTCATGG - Intergenic
1022164220 7:27741643-27741665 GGCGCGCACCACCACACTGAAGG + Intronic
1027002292 7:74661961-74661983 CTGCCACACCACCACACAGAAGG + Intronic
1030084528 7:105805297-105805319 TTCCCACCCCACAGCACTAAGGG - Intronic
1030119160 7:106089639-106089661 GTCCAAAACCACCACCCTAACGG + Intergenic
1031407357 7:121402683-121402705 ACCCCTCACCACCACACAAAAGG + Intergenic
1032831604 7:135632749-135632771 GTTCCACCCCACAACACTACAGG - Intronic
1034900479 7:154905278-154905300 GTCTCACACCACCACGCTGCTGG + Intergenic
1040688062 8:49900273-49900295 GCCCCACACCAGAACACCAAAGG - Intergenic
1043251216 8:78076060-78076082 GTCCCACATAATGACACTAAAGG + Intergenic
1046128736 8:109942021-109942043 GTCCCACACCACCGGACTCCTGG + Intergenic
1046430148 8:114113791-114113813 GCCCCACTCCCCCACACAAAAGG + Intergenic
1048656211 8:136539690-136539712 GGCACACACCACCATTCTAAAGG - Intergenic
1051457001 9:17269815-17269837 GTTCTAGACCACCACAATAAAGG + Intronic
1053230085 9:36400857-36400879 GTCCCGCAACACCGCACTAGGGG + Intronic
1056100885 9:83299701-83299723 GTCCCGCATCACCACAGGAATGG + Intronic
1058655460 9:107216674-107216696 TTCCCACACAACCTCACTACTGG - Intergenic
1060980832 9:127790747-127790769 GACCCAGACCACAACACAAAAGG + Exonic
1062059572 9:134487701-134487723 GTCCCTCACCAGCAGACTGAAGG - Intergenic
1062619698 9:137414778-137414800 GTCCCACACCGCCACTCCAGGGG + Intronic
1186759504 X:12708741-12708763 CTCCCACACCAGCACCCTAGTGG - Intronic
1188103440 X:26119110-26119132 GTCCAACATCATCACACTATGGG + Intergenic
1194492903 X:94573496-94573518 ATCTCACACAAGCACACTAATGG - Intergenic
1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG + Intergenic