ID: 930122956

View in Genome Browser
Species Human (GRCh38)
Location 2:47774823-47774845
Sequence CTGTAGTAGGAGAAGTTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930122956 Original CRISPR CTGTAGTAGGAGAAGTTGAA GGG Intronic
900247769 1:1646090-1646112 CTGTCATAGGAGAGCTTGAATGG - Intronic
900258996 1:1713244-1713266 CTGTCATAGGAGAGCTTGAATGG - Intronic
904433394 1:30479381-30479403 CTGTAGCGGGAGAGGTTGAGAGG - Intergenic
905723066 1:40224168-40224190 CTGTAGCAGGAAGAGATGAATGG + Intronic
909176143 1:72362584-72362606 CTCTGGCATGAGAAGTTGAAAGG - Intergenic
909669567 1:78172831-78172853 CTGTAGGCTGAGAAGTTCAAGGG - Intergenic
910609118 1:89121271-89121293 CTGTAGAAGGAGAGGATAAAAGG + Intronic
910850194 1:91642297-91642319 TTGTAGGAGGAGGAGTGGAAAGG - Intergenic
911146752 1:94559849-94559871 CTCTAGGGGGACAAGTTGAATGG - Intergenic
911713160 1:101098199-101098221 CTGTAGGCTGAGAAGTTTAAGGG - Intergenic
915042889 1:152983383-152983405 CTGAAGTAGGAGAAGGGTAAAGG + Intergenic
917097884 1:171417796-171417818 CTGTGGGAGGACAAGGTGAAAGG - Intergenic
917440154 1:175061824-175061846 CTGAAGTAGGAAAACTTGAGAGG + Intergenic
920801096 1:209188220-209188242 CTGTAGGATGACAAGATGAAGGG - Intergenic
920855609 1:209658887-209658909 CTGGAGGAGGAGAAGAGGAATGG - Intergenic
1063945360 10:11170674-11170696 GTGGAGGAGGAGGAGTTGAAGGG + Intronic
1064532526 10:16324736-16324758 CTGGACAAAGAGAAGTTGAAGGG + Intergenic
1069252693 10:66290098-66290120 TAGTAGTAGGAGAAGTTGGGTGG + Intronic
1070267983 10:74923221-74923243 AAGGAGTAGGAGAAGTAGAAGGG + Intronic
1071492443 10:86144872-86144894 GTTTAGGAGGAGAAGTTGAAAGG - Intronic
1078476153 11:11632325-11632347 CTGAAATAGAAGAAGTTGCACGG + Intergenic
1079110095 11:17600523-17600545 CTGTGGTGGGTGAAGTGGAAAGG + Intronic
1079523302 11:21354551-21354573 CTGGAGTTGGGGAAGCTGAAAGG - Intronic
1083868415 11:65471469-65471491 CTGTATTTGGAGAGGCTGAAGGG + Intergenic
1086111185 11:83200194-83200216 GAGTAGTAAGAGAAGCTGAAAGG - Intronic
1086165811 11:83776465-83776487 CTGGGGTAGGACCAGTTGAAAGG - Intronic
1088087672 11:106001097-106001119 TTGTGGTAGGAGAACTTGGAGGG + Intronic
1088576711 11:111279266-111279288 GTGTAGTATGAGAAGTGGCAGGG - Intronic
1092014971 12:5151102-5151124 TTGGAGGAGGAGGAGTTGAATGG - Intergenic
1092727819 12:11501435-11501457 CAGTAGTAGAAGTATTTGAATGG + Intergenic
1092796747 12:12118573-12118595 CTGTAATTGGAAAAGTTGAGAGG - Exonic
1094502819 12:31036042-31036064 CTGTAGAAGGAGAGGTTGCCAGG - Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1099302773 12:80918524-80918546 CTTTAGTAAGAGTAGATGAAGGG - Intronic
1102564059 12:113783116-113783138 CTGCAGGAGGAGAAGTGGAGAGG - Intergenic
1103275184 12:119705318-119705340 TTGTAGCAGGAGACGTTAAAAGG - Intronic
1103883748 12:124186006-124186028 CTGTAAAAGGAGAATTTGAACGG - Intronic
1104594659 12:130112953-130112975 CTGTAGGAGGAGCAGGTGATAGG - Intergenic
1109277435 13:60318192-60318214 CTCCAGTAGGAGAATTTTAAGGG - Intergenic
1109950150 13:69490630-69490652 CTGGAGTAGTAGCAGTTGCATGG - Intergenic
1110047315 13:70846285-70846307 CTGTGGTAGGAAAAGGTCAATGG - Intergenic
1112421468 13:99254019-99254041 CTTTATTAGGAGAAATTAAATGG + Intronic
1112709518 13:102111245-102111267 CTCTAGTAGAAGAGGTAGAAAGG - Intronic
1113611189 13:111645954-111645976 CTGCAATAGGTGAAGTGGAAAGG + Intronic
1116175778 14:41468874-41468896 CTTTGGTAGGTGAATTTGAAAGG - Intergenic
1118819471 14:69335607-69335629 CCGTGGTTGGAGAACTTGAAAGG + Intronic
1119265823 14:73262805-73262827 CTGTAGGAGGAGCTGTGGAAGGG - Exonic
1119946775 14:78703689-78703711 CTGAAGTTGGAGAAATGGAATGG - Intronic
1125736085 15:41926859-41926881 CTGTAGTTGGAGAAGAGGAAAGG - Intronic
1126896358 15:53261230-53261252 CTGGAGTAGGAGAAGCAGACTGG + Intergenic
1127823930 15:62686632-62686654 CTGTTTCAGGAGAAGATGAAAGG + Exonic
1128220947 15:65968170-65968192 CAGAAGGAGGAGAAGTAGAATGG + Intronic
1129324335 15:74792184-74792206 CTGTAGTAGCAGGAGATGATGGG - Intronic
1130807080 15:87334649-87334671 CACTAGTAGGAGGAGTTAAAGGG + Intergenic
1130852907 15:87815392-87815414 TTGTAATAGTAGAAGCTGAATGG + Intergenic
1133829610 16:9309618-9309640 CTGTACTTTGAGTAGTTGAAAGG + Intergenic
1134592057 16:15462534-15462556 CTGCAGTGGGAGAAGGTGATTGG + Intronic
1135490017 16:22900951-22900973 CTGTCGCAGGAGCAGGTGAAGGG + Intronic
1136309489 16:29397839-29397861 CTGGAGGAGGAGAAGAAGAAAGG + Intronic
1137581879 16:49638637-49638659 CTGCAGTAGGTGCACTTGAACGG + Exonic
1139478658 16:67216142-67216164 CTGAAGAAGGAGCAGTGGAAAGG - Intronic
1142529640 17:571211-571233 CTGAAGTAGGAGGAGGGGAAGGG + Intronic
1142668804 17:1477907-1477929 CTGGTGGAGGAGAAGTTTAAGGG - Exonic
1142755042 17:2011468-2011490 CTGTGGGAGGGGAAGATGAAAGG + Intronic
1143669611 17:8387348-8387370 CGGTAGGAGGAGGAGTTGTAAGG + Intergenic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1147986561 17:44310469-44310491 CCAGAGAAGGAGAAGTTGAAGGG + Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1151156172 17:72124121-72124143 CTGTAGTGTGGGAGGTTGAAGGG - Exonic
1151734462 17:75930414-75930436 CTGTAGTAAGATGAGTGGAAAGG - Intronic
1153851573 18:9100254-9100276 CTTTATTAGGAGAATGTGAAAGG - Intergenic
1155381544 18:25227463-25227485 CTGCAGTAGGTGCATTTGAAAGG + Exonic
1155702804 18:28768894-28768916 CTCTCTTAGGAGAAGTTGTAAGG + Intergenic
1157173392 18:45428623-45428645 CTGTACTTGGAAAAGTAGAAAGG + Intronic
1158594573 18:58804871-58804893 CTGTAGTTAGAGAAGAAGAAAGG - Intergenic
1160226519 18:77016285-77016307 CTGTGGTCTGAGAAGTGGAAGGG - Exonic
1161379850 19:3959123-3959145 CTGGAGCAGGAGAAGCTGCAGGG - Exonic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1167167511 19:47809106-47809128 CTGTAATAGGAAAAGCTCAAAGG + Intronic
928433474 2:31239044-31239066 CTGAAGTGGGAGAAGCTGAAAGG - Intronic
928752353 2:34485714-34485736 CTGGAGTAGGAAAAGTGGGATGG - Intergenic
928930669 2:36620529-36620551 CAGAAGAAGGAGAAGCTGAAAGG - Intronic
930122956 2:47774823-47774845 CTGTAGTAGGAGAAGTTGAAGGG + Intronic
930257551 2:49109470-49109492 CTGTAGTGGGCAAAGTTGAATGG + Intronic
930381969 2:50641492-50641514 CTGAAGTAGGAAAGGCTGAAGGG - Intronic
933126498 2:78614564-78614586 CTTTAGCAGGTGAAGTTGAAAGG - Intergenic
934308568 2:91844382-91844404 CTGTAGAAAGAGAAGGTGAGGGG - Intergenic
935213048 2:100954736-100954758 TTGGAGTTGGAGAAGTTGTATGG - Intronic
937466151 2:122134880-122134902 CTGTGGTAGGACTAGTCGAAAGG + Intergenic
939183606 2:138833284-138833306 CTGTAGTGGGTGCAGGTGAAGGG + Intergenic
939950044 2:148459454-148459476 CTGTTGTAGAACAAGTTGAATGG + Intronic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
942812042 2:180010910-180010932 CTGTAGAGGGAGAAGTTGCCCGG - Intergenic
944865482 2:203856038-203856060 CGGTTTTTGGAGAAGTTGAAAGG - Intergenic
945019572 2:205557440-205557462 CTGCAGGAGCAGAAGTTGAGGGG - Intronic
945126369 2:206515527-206515549 CTGTAGGAGCAGAAGATTAAAGG - Intronic
945274804 2:207977466-207977488 CTGTAGAAGTATAAGTTGTAAGG + Exonic
946963178 2:225006601-225006623 GTGTAGTAGGAGGACTAGAACGG - Intronic
947351883 2:229254886-229254908 CTGCAGTAGCAGAAAATGAAAGG - Intronic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
1168760085 20:344627-344649 CTGTAGAAGGCGAAGGGGAAGGG - Intergenic
1170770530 20:19328618-19328640 CAGTTGTAGGAGAAGGTGAGGGG + Intronic
1178191246 21:30283518-30283540 ATGTATTAGGAGAAGTTCATAGG + Intergenic
1178524550 21:33316011-33316033 CTGCAGTAAGAGATGTTTAAGGG - Intergenic
1181913262 22:26257357-26257379 CTGTAAAATGAGAAGTTAAATGG - Intronic
1183259707 22:36786595-36786617 CTCGGGTGGGAGAAGTTGAAAGG - Intergenic
951682062 3:25305254-25305276 CTGTAGGAGGAGAGGTTTTAAGG + Intronic
952173421 3:30835007-30835029 CTGTATTGAGAGAATTTGAAGGG + Intronic
953150556 3:40320435-40320457 CTGGAGTAGGGGAAGAAGAAGGG + Intergenic
955247265 3:57236712-57236734 CTGGAGTACAAGAAGATGAAGGG + Intronic
955434013 3:58881003-58881025 GTGAAGTAGGAGAACTTAAAAGG - Intronic
958270244 3:91490687-91490709 CTGTAGAAGGAGGACTTGTAGGG - Intergenic
958735420 3:98003737-98003759 CTGTCGTAGGACAAGATGCATGG - Intronic
962503045 3:136014919-136014941 CTGAACAAGGAAAAGTTGAAAGG - Intronic
963667322 3:148205007-148205029 CTGAAGTGTGAGAAGTTGTAAGG - Intergenic
965327470 3:167324890-167324912 TTGTAGAAGAAGAAGTTGGAAGG - Intronic
965647074 3:170895390-170895412 CTGTAGTAAAAGAAGTTCAGTGG - Intronic
967595488 3:191323060-191323082 CAGTCTTAGGAGAAGTTGATGGG + Intronic
969364411 4:6685862-6685884 CTGGAGGAGGAGGAGTTGAGAGG - Intergenic
970451282 4:16168643-16168665 CAGTAGTATGAGGAGATGAATGG - Intronic
971607125 4:28671973-28671995 CTTTAGTTTGAGAACTTGAAGGG - Intergenic
972097410 4:35364927-35364949 CAGTATTAGGAGAAGTAGCAGGG - Intergenic
972154344 4:36140054-36140076 CTTTAGTAGGAAAAAATGAAGGG - Intronic
972362847 4:38344961-38344983 CTGTCATAGTGGAAGTTGAAGGG - Intergenic
975695514 4:77008935-77008957 CTTTAGATGGAGAAGTGGAAAGG + Intronic
978810612 4:112845580-112845602 CTGGGGTTGGGGAAGTTGAATGG + Intronic
979884091 4:126002559-126002581 TTGTATTAGGAGAATTTGTATGG - Intergenic
980550760 4:134331091-134331113 CTGTAGTATTAGAAGTTGTCTGG - Intergenic
983627163 4:169813536-169813558 CTGTTATAAGAGAAGTTGAAGGG - Intergenic
987736746 5:21855434-21855456 CTGTACTAAAAGAAGTTGAAGGG + Intronic
989258860 5:39396837-39396859 CTGTCAGAGGAAAAGTTGAAAGG + Intronic
990467463 5:56083605-56083627 CTGTAGTAGGAAGAATGGAAAGG - Intergenic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
990992439 5:61699259-61699281 CACGAGTAGGAGAAATTGAAAGG - Intronic
991188118 5:63834824-63834846 CTGTAGGCTGAGAAGTTCAAGGG - Intergenic
992149564 5:73889673-73889695 CTAATGTAGGAGAAGATGAAAGG - Intronic
992544409 5:77797429-77797451 CTCTAGAAGAAGAAGGTGAAAGG + Intronic
992741030 5:79773882-79773904 GTGTAGGAAGACAAGTTGAAAGG + Intronic
992780414 5:80122128-80122150 CTGTAGTAGGACAAATTCTAGGG + Intronic
995380526 5:111527378-111527400 CTGTGGTAGCAGCAGATGAATGG - Intergenic
995559435 5:113364624-113364646 CTGTACTAGGACAATATGAAGGG - Intronic
995909009 5:117163305-117163327 CTGTAGAAGCAGAAGTTTCATGG + Intergenic
996054320 5:118966613-118966635 CTATAGAAGGAAAAGTTGATAGG + Intronic
996809777 5:127503795-127503817 CTGTAGTTGGAGAAGAAGTAGGG + Intergenic
997872046 5:137514862-137514884 CTCTAGAAGGAGAAGTTGCAGGG + Intronic
998589887 5:143465720-143465742 CTGTAGGTTGAGAAGTTCAAAGG + Intergenic
999028847 5:148267357-148267379 CTGTTGGAGGATAAATTGAAGGG + Intergenic
1000668018 5:164023053-164023075 AGGTAGTAAGAAAAGTTGAATGG + Intergenic
1002809385 6:612358-612380 CTAAAGTAGGAGAAGAGGAAGGG + Intronic
1007957454 6:45930318-45930340 TTGTAGAAGGAGAAGAGGAAAGG + Intronic
1008984911 6:57530670-57530692 CTGTAGGAGGAGGACTTGCAGGG + Intronic
1009172951 6:60423612-60423634 CTGTAGAAGGAGGACTTGCAGGG + Intergenic
1012593790 6:101016673-101016695 CAGCAGTAGGAGAAATGGAAAGG + Intergenic
1014835350 6:126155171-126155193 CAATCATAGGAGAAGTTGAAGGG + Intergenic
1015701916 6:136045746-136045768 ATGTGGTAGTAGAAATTGAAAGG + Intronic
1020550864 7:9602798-9602820 CTGTGGTGGCAGAAGGTGAAAGG - Intergenic
1022145902 7:27540204-27540226 ATGTTGTAAAAGAAGTTGAAAGG + Intronic
1024522642 7:50319590-50319612 CTGTAGTAGGAAAAGCCTAAGGG + Intronic
1030579450 7:111335021-111335043 CTGTAGCAGGAGCAGTTTATAGG + Intronic
1034376398 7:150648764-150648786 CTGAATGAGGGGAAGTTGAAGGG - Intergenic
1034819364 7:154202660-154202682 CTGTAGTAGGAGGGGATGACGGG - Intronic
1035438350 7:158876144-158876166 CAGTCTTAGGAGAAGGTGAAGGG + Intronic
1036181360 8:6588194-6588216 CTGGACTAGGAGAAGGTGGAGGG - Intronic
1038081805 8:24146022-24146044 CTGTAGTCTATGAAGTTGAAGGG + Intergenic
1038486228 8:27937172-27937194 CTGTAGTAGTATAAAGTGAATGG + Intronic
1042374611 8:68035757-68035779 CTGTGGTAGAAGATGGTGAAAGG + Intronic
1043291313 8:78605050-78605072 CTGTAGTAGCAGTAGTAGTAGGG + Exonic
1043520996 8:81045053-81045075 CTTTGCTAGGAGATGTTGAATGG - Intronic
1044022039 8:87116831-87116853 CTGAGGTGGGAGATGTTGAAAGG - Intronic
1044257897 8:90087251-90087273 ATGTAGAAGTAGAAGCTGAATGG + Intronic
1046553410 8:115745492-115745514 ATGTAGTAGGAGCAGAGGAAAGG - Intronic
1047140074 8:122128501-122128523 CTGTAGAAGGAAAAGATGCAAGG + Intergenic
1048077930 8:131093875-131093897 CTGTAGTAGGAGATGTGTCAGGG + Intergenic
1049191355 8:141289650-141289672 CTGTAGTAAGAGAAGCTAAGAGG + Intronic
1051828667 9:21251263-21251285 CTGTAGTGTGAGAACTTGATGGG + Intergenic
1058630356 9:106980082-106980104 AGGTATTTGGAGAAGTTGAAAGG - Intronic
1186562826 X:10630942-10630964 CTGCAGGAGGAGCAGTTGATAGG + Intronic
1188731813 X:33657131-33657153 CTGTTTTAGGAGTAGTTGCAAGG - Intergenic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193592281 X:83404569-83404591 CTGCAGACTGAGAAGTTGAAGGG - Intergenic
1194483146 X:94452222-94452244 TTGTAATAAGAAAAGTTGAAAGG + Intergenic
1197440112 X:126477130-126477152 CTGGAGAAAGAGAAGGTGAAGGG + Intergenic
1197920467 X:131587884-131587906 CTGTAGTCCAAGAAGTTGAAGGG + Intergenic
1198684427 X:139212526-139212548 CTGCACTGGGAGAAGTAGAATGG - Intronic
1199537340 X:148917637-148917659 CAGTAGTTGGAGAAGTTGGATGG + Intronic
1199836415 X:151596207-151596229 CTGCAGGATGAGAAGTTCAAGGG + Intronic
1200915306 Y:8566155-8566177 CTGTAGGATGAGAAGCAGAAAGG + Intergenic
1201274373 Y:12284603-12284625 GTGTAGTAGGTGATGTTGGAGGG + Intergenic
1201893542 Y:18969550-18969572 CAGTAGAGGGACAAGTTGAAAGG - Intergenic