ID: 930123097

View in Genome Browser
Species Human (GRCh38)
Location 2:47775925-47775947
Sequence CAAGTGCAAAAAATTTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1627
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 1569}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930123094_930123097 5 Left 930123094 2:47775897-47775919 CCATTTATCAGATTAGGAGACCA 0: 1
1: 0
2: 5
3: 65
4: 605
Right 930123097 2:47775925-47775947 CAAGTGCAAAAAATTTACCCAGG 0: 1
1: 0
2: 2
3: 55
4: 1569
930123090_930123097 29 Left 930123090 2:47775873-47775895 CCATAAGCAAATATTAGTGAATC 0: 1
1: 0
2: 0
3: 24
4: 312
Right 930123097 2:47775925-47775947 CAAGTGCAAAAAATTTACCCAGG 0: 1
1: 0
2: 2
3: 55
4: 1569
930123093_930123097 6 Left 930123093 2:47775896-47775918 CCCATTTATCAGATTAGGAGACC 0: 1
1: 0
2: 7
3: 69
4: 871
Right 930123097 2:47775925-47775947 CAAGTGCAAAAAATTTACCCAGG 0: 1
1: 0
2: 2
3: 55
4: 1569
930123092_930123097 7 Left 930123092 2:47775895-47775917 CCCCATTTATCAGATTAGGAGAC 0: 1
1: 1
2: 14
3: 255
4: 2124
Right 930123097 2:47775925-47775947 CAAGTGCAAAAAATTTACCCAGG 0: 1
1: 0
2: 2
3: 55
4: 1569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930123097 Original CRISPR CAAGTGCAAAAAATTTACCC AGG Intronic
900694909 1:4003757-4003779 AAAGTACAAAAAAATTAGCCAGG + Intergenic
900871575 1:5307875-5307897 AAAATACAAAAAAATTACCCCGG + Intergenic
901015541 1:6227693-6227715 AAAATACAAAAAATTTAGCCAGG + Intronic
901349868 1:8584986-8585008 AAAGTACAAAAAAATTAGCCAGG + Intronic
901510276 1:9715014-9715036 AAAATACAAAAAATTTAGCCAGG + Intronic
901707634 1:11087761-11087783 AAAATGTAAAAATTTTACCCAGG + Intronic
901854082 1:12032979-12033001 AAAGTACAAAAAAATTAGCCAGG - Intergenic
902200800 1:14832033-14832055 AAAGTACAAAAAAATTAGCCAGG + Intronic
902324642 1:15691789-15691811 CAAGTACAAAAAAATTAGCTGGG + Intronic
902537312 1:17127213-17127235 AAAATGCAAAAAAATTAACCAGG + Intergenic
902595035 1:17503667-17503689 AAAATGCAAAAAAATTAGCCAGG - Intergenic
902794059 1:18788931-18788953 AAAGTACAAAAAATTTAGCTGGG - Intergenic
902901611 1:19520640-19520662 AAAATACAAAAAATTTAGCCGGG - Intergenic
902920178 1:19661356-19661378 AAAATGCAAAAAAATTAGCCGGG - Intergenic
902981985 1:20130639-20130661 AAAATACAAAAAATTTAGCCAGG - Intergenic
903060049 1:20663061-20663083 CTAATACAAAAAATTTAGCCGGG + Intergenic
903213364 1:21830527-21830549 AAAATGCAAAAAATTTAGCCAGG + Intronic
903350989 1:22716490-22716512 AAAATGCAAAAAAATTAGCCGGG - Intronic
903949752 1:26989432-26989454 AAAATACAAAAAAGTTACCCGGG - Intergenic
904145827 1:28390630-28390652 AAAGTACAAAAAAATTAGCCGGG + Intronic
904156144 1:28484805-28484827 AAATTACAAAAAATTTAGCCGGG + Intronic
904166409 1:28558723-28558745 AAAATGCAAAAAAATTAGCCAGG - Intronic
904166899 1:28562739-28562761 AAAATACAAAAAATTTAGCCAGG - Intronic
904178712 1:28650282-28650304 AAAATACAAAAAATTTAGCCGGG + Intergenic
904224729 1:29006737-29006759 CAAATACAAAAAAATTAGCCAGG + Intronic
904242666 1:29158944-29158966 AAAATACAAAAAAATTACCCGGG + Intronic
904318370 1:29680641-29680663 AAAGTACAAAAAAATTAGCCAGG - Intergenic
904690082 1:32287308-32287330 AAAATACAAAAAAATTACCCAGG - Intergenic
904743780 1:32698356-32698378 AAAGTACAAAAAAATTAGCCAGG + Intronic
904754987 1:32763730-32763752 AAAGTACAAAAAAATTAGCCGGG - Intronic
904780454 1:32942978-32943000 AAAATACAAAAAATTTAGCCGGG + Intronic
905042802 1:34974146-34974168 AAAGTACAAAAAAATTACCCGGG - Intergenic
905528065 1:38654435-38654457 CAAATACAAAAAAATTAGCCAGG + Intergenic
905610057 1:39342677-39342699 AAAATACAAAAAATTTAGCCTGG - Intronic
905707121 1:40068990-40069012 AAAGTACAAAAAAATTAGCCGGG - Intronic
905714623 1:40137872-40137894 AAAATGCAAAAAAATTAACCAGG + Intergenic
905988714 1:42313174-42313196 AAAATACAAAAAATTTAGCCGGG + Intronic
906015344 1:42572775-42572797 AAAGTACAAAAAAATTAGCCAGG - Intronic
906158734 1:43631055-43631077 AAAATACAAAAAATTTAGCCAGG - Intergenic
906342302 1:44991357-44991379 AAAATACAAAAAAATTACCCCGG + Intergenic
906354677 1:45094355-45094377 AAAATGCAAAAAAATTAGCCAGG - Intronic
906403009 1:45519754-45519776 GAAGTACAAAAAAATTAGCCGGG - Intronic
906620964 1:47278840-47278862 CAATTTCAAAGAATTTACCTAGG + Intronic
906623304 1:47303402-47303424 CAAATACAAAAAAATTAGCCAGG + Intronic
906753413 1:48286876-48286898 AAAGTACAAAAAATTTATCTGGG + Intergenic
906755462 1:48310207-48310229 CCAGTGCAAAATCTTTGCCCTGG - Intronic
906764657 1:48417653-48417675 CAAATACAAAAAAATTAGCCAGG + Intronic
907098178 1:51801003-51801025 CAAAAGCAAAAAAATTAGCCGGG - Intronic
907196776 1:52693414-52693436 AAAATGCAAAAAAATTAGCCAGG + Intronic
907360343 1:53908931-53908953 AAAGTACAAAAAAATTAGCCAGG + Intronic
907699186 1:56766595-56766617 AAAATACAAAAAATTTAGCCAGG - Intronic
907788858 1:57641542-57641564 AAAGTACAAAAAAATTAGCCAGG - Intronic
907996992 1:59642872-59642894 AAAGTACAAAAAAATTAGCCGGG + Intronic
908134701 1:61118633-61118655 CAAGTGCAAAAAGTTTGGTCGGG + Intronic
908198797 1:61773180-61773202 AAAGTACAAAAAAATTAGCCGGG - Intronic
908235947 1:62147495-62147517 CAAATACAAAAAAATTAGCCAGG + Intronic
908344099 1:63213772-63213794 AAAATGCAAAAAAATTAGCCAGG + Intergenic
908504838 1:64786630-64786652 AAAATGCAAAAAACTTAGCCAGG + Intronic
908528935 1:65014843-65014865 AAAGTACAAAAAAATTAGCCGGG - Intergenic
909289045 1:73858968-73858990 CAAATGCAAAAAAATTAGCCAGG - Intergenic
909607894 1:77525065-77525087 AAAGTACAAAAAAATTAGCCAGG - Intronic
909618191 1:77636552-77636574 AAAATACAAAAAATTTATCCAGG + Intronic
909632440 1:77781065-77781087 CAAATACAAAAAAATTAGCCAGG - Intronic
909854049 1:80505855-80505877 AAAATGCAAAAAAATTAACCAGG - Intergenic
910071252 1:83216334-83216356 CATGTGCAAAAAAGGTACACTGG + Intergenic
910691070 1:89966254-89966276 AAAATGCAAAAAAGTTAGCCGGG + Intergenic
910994165 1:93086343-93086365 AAAATACAAAAAATTTAGCCAGG + Intronic
910998772 1:93139548-93139570 AAAATGCAAAAAAATTAGCCTGG + Intergenic
911008205 1:93250218-93250240 AAAGTGAAAAAAAATTAGCCAGG + Intronic
911061204 1:93749426-93749448 AAAGTACAAAAAAATTAGCCAGG + Intronic
911172495 1:94784156-94784178 AAAGTACAAAAAAATTAGCCGGG - Intergenic
911245517 1:95512121-95512143 CAAATGCAAAACATTTCCCTAGG + Intergenic
911753283 1:101523385-101523407 AAAGTACAAAAAAATTAGCCGGG + Intergenic
911948884 1:104147133-104147155 AAAGTACAAAAAAATTAGCCGGG + Intergenic
912077735 1:105897871-105897893 CAAATACAACAAAATTACCCAGG + Intergenic
912282897 1:108335655-108335677 AAAATACAAAAAATTTAGCCGGG + Intergenic
912388650 1:109286055-109286077 AAAGTACAAAAAAATTAGCCGGG + Intergenic
912436659 1:109666884-109666906 AAAATGCAAAAAAATTAGCCAGG - Intronic
912674426 1:111664211-111664233 CAAATACAAAAAAATTATCCGGG + Intronic
912806335 1:112759618-112759640 AAAATACAAAAAAATTACCCGGG + Intergenic
912814590 1:112818825-112818847 AAAGTACAAAAAAATTAACCAGG + Intergenic
912916565 1:113821480-113821502 AAAATACAAAAAATTTACCCAGG - Intronic
912938148 1:114021560-114021582 CAAATACAAAAAAATTAGCCGGG - Intergenic
914045687 1:144089991-144090013 AAAATGCAAAAAAATTAGCCGGG + Intergenic
914076637 1:144358511-144358533 AAAGTACAAAAAAATTAGCCGGG + Intergenic
914102541 1:144607986-144608008 AAAGTACAAAAAAATTAGCCGGG - Intergenic
914132423 1:144870695-144870717 AAAATGCAAAAAAATTAGCCGGG - Intergenic
914391184 1:147224668-147224690 AAAATGCAAAAAAATTAGCCGGG - Intronic
914425662 1:147573290-147573312 AAAATACAAAAAAATTACCCTGG + Intronic
914782690 1:150800034-150800056 AAAATGCAAAAAAATTAGCCAGG + Intronic
914796063 1:150921368-150921390 AAAATACAAAAAAATTACCCGGG + Intergenic
914864535 1:151415508-151415530 AAAATGCAAAAAAATTAGCCGGG + Intronic
914890491 1:151618014-151618036 AAAGTACAAAAAAATTAGCCAGG - Intronic
915132120 1:153702740-153702762 AAAATACAAAAAATTTAGCCAGG - Intergenic
915152832 1:153848791-153848813 AAAGTACAAAAAAATTAGCCAGG + Intronic
915154519 1:153863782-153863804 AAAATACAAAAAAATTACCCAGG - Intronic
915158443 1:153898143-153898165 AAAGTACAAAAAAATTAGCCAGG + Intronic
915247012 1:154563294-154563316 AAAATGCAAAAAAATTAGCCGGG + Intergenic
915379591 1:155428278-155428300 AAAGTACAAAAAAATTAGCCGGG + Intronic
915406627 1:155664928-155664950 AAAGTACAAAAAAATTAGCCGGG - Intronic
915820611 1:159019617-159019639 AAAATACAAAAAATTTAGCCAGG - Intronic
915820832 1:159022122-159022144 AAAATACAAAAAATTTAGCCGGG - Intronic
915863990 1:159478381-159478403 AAAATGCAAAAAAATTAGCCAGG - Intergenic
915916644 1:159944595-159944617 GAAGTGTACAAAATTAACCCTGG + Intronic
916486582 1:165265041-165265063 AAAATGCAAAAAAATTAGCCGGG + Intronic
916886670 1:169075195-169075217 AAAGTACAAAAAAATTAGCCAGG + Intergenic
917376359 1:174351960-174351982 CAAAAGCAAAAAAATTAGCCAGG - Intronic
917416340 1:174814216-174814238 CATGTCCAAAAAATTTATTCTGG - Intronic
917775655 1:178331745-178331767 AAAGTACAAAAAAATTAGCCAGG - Intronic
917988742 1:180350184-180350206 CAAGTAAAAAATATTTAGCCAGG - Intronic
918293168 1:183129246-183129268 AAAATACAAAAAAATTACCCCGG - Intronic
918376049 1:183910255-183910277 AAAATACAAAAAAATTACCCAGG - Intronic
919034841 1:192293359-192293381 CAAATCCAAAAAAATTAGCCGGG - Intergenic
919404723 1:197165447-197165469 AAAATGCAAAAAAATTAGCCGGG + Intronic
919903604 1:202061889-202061911 AAAATGCAAAAAAATTAGCCAGG + Intergenic
920145308 1:203856007-203856029 AAAGTACAAAAAAATTAGCCAGG + Intergenic
920214031 1:204349378-204349400 AAAGTACAAAAAATTTAGCTGGG + Intronic
920439538 1:205970134-205970156 AAAATACAAAAAATTTAGCCAGG + Intergenic
920884467 1:209913117-209913139 GAAGTGCAAGAGATTTACCGAGG - Intergenic
921000417 1:211038118-211038140 AAAATACAAAAAATTTAGCCAGG - Intronic
921050399 1:211506984-211507006 AAAATGCAAAAAAATTAGCCAGG + Intergenic
921252875 1:213313790-213313812 AAAGTACAAAAAAATTAGCCGGG + Intergenic
921516754 1:216102637-216102659 AAAGTACAAAAAAATTAGCCGGG + Intronic
921665737 1:217868838-217868860 AAAGTACAAAATATTTAGCCAGG - Exonic
921723772 1:218502237-218502259 AAAATGCAAAAAAATTAGCCAGG + Intergenic
921966492 1:221096157-221096179 AAAATACAAAAAATTTACCTGGG - Intergenic
922051794 1:221997822-221997844 GAAGTACAAAAAAATTAACCAGG + Intergenic
922068363 1:222166508-222166530 AAAATACAAAAAAATTACCCGGG + Intergenic
922410414 1:225368617-225368639 CAATTGCAAGAAAATTAACCCGG - Intronic
922439549 1:225642038-225642060 CAAATACAAAAAAATTAGCCAGG + Intronic
922464487 1:225837676-225837698 AAAATACAAAAAAATTACCCGGG - Intronic
922491937 1:226024833-226024855 AAAATGCAAAAAAATTAGCCAGG + Intergenic
922530646 1:226342418-226342440 AAAGTACAAAAAAATTAGCCAGG + Intergenic
924012807 1:239684534-239684556 AAAATGCAAAAAAATTAGCCGGG + Intronic
924256713 1:242190304-242190326 AAAGTACAAAAAAATTAGCCGGG - Intronic
924279259 1:242419554-242419576 AAAATGCAAAAAATTTAGCCGGG - Intronic
924433478 1:244017877-244017899 AAAGTGAAAAAAAATTACACAGG - Intergenic
924503969 1:244663515-244663537 CAAAGGCAAAAAAGTTACACGGG + Intronic
924610479 1:245569447-245569469 AAAGTACAAAAAAATTAGCCGGG + Intronic
924757637 1:246956146-246956168 AAAATGCAAAAAAATTAGCCGGG - Intronic
924935933 1:248770247-248770269 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1063312408 10:4966386-4966408 CAAGTGTAAGAAACTCACCCAGG - Intronic
1063343444 10:5290249-5290271 AAAATGCAAAAAATTTAGCCGGG - Intergenic
1063679448 10:8173035-8173057 AAACTGCAAAAAAATTAGCCAGG - Intergenic
1063842049 10:10083159-10083181 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1064068741 10:12206796-12206818 AAAATGCAAAAAAATTAGCCGGG + Intronic
1064090607 10:12380052-12380074 AAAATGCAAAAAAATTAGCCGGG + Intronic
1064258413 10:13765273-13765295 AAAATGCAAAAAAATTAGCCAGG - Intronic
1064359135 10:14647521-14647543 AAAGTACAAAAAAATTAGCCAGG + Intronic
1064435842 10:15310699-15310721 CAAATACAAAAAAATTAGCCAGG + Intronic
1064670334 10:17707247-17707269 AAAATACAAAAAATTTAGCCTGG + Intronic
1064766773 10:18683221-18683243 AAAGTACAAAAAAATTACGCGGG - Intergenic
1064797953 10:19035217-19035239 AAAATACAAAAAAATTACCCGGG + Intergenic
1065194867 10:23254366-23254388 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1065513425 10:26502479-26502501 CAAATACAAAAAAATTAGCCAGG + Intronic
1065531489 10:26674735-26674757 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1065540548 10:26762165-26762187 AAAATACAAAAAATTTAGCCGGG - Intronic
1065583322 10:27193266-27193288 AAAATACAAAAAAATTACCCAGG + Intergenic
1065892936 10:30136447-30136469 TAAGTGCAAAATATTTTCACAGG - Intergenic
1065900616 10:30204359-30204381 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1066397298 10:35038363-35038385 AAAGTACAAAAAAATTAGCCAGG + Intronic
1066542342 10:36460768-36460790 GAAATGCAAAAAAATTAGCCGGG - Intergenic
1066561194 10:36671571-36671593 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1066672340 10:37853536-37853558 AAAGTACAAAAAAATTAGCCGGG - Intronic
1066701687 10:38136302-38136324 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1067363836 10:45606722-45606744 AAAGTACAAAAAAGTTAGCCAGG + Intergenic
1067369509 10:45670385-45670407 AAAATGCAAAAAAATTAGCCGGG - Intronic
1067396694 10:45926460-45926482 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1067676274 10:48380571-48380593 AAAGTACAAAAAAATTAGCCGGG + Intronic
1067865008 10:49895562-49895584 AAAGTACAAAAAAATTAGCCAGG - Intronic
1067991577 10:51219547-51219569 AAAATACAAAAAAATTACCCGGG + Intronic
1067991762 10:51222033-51222055 CAAATACAAAAAAATTAGCCAGG - Intronic
1068520500 10:58071982-58072004 CAAGTATAAATCATTTACCCTGG - Intergenic
1069444930 10:68464352-68464374 AAAGTACAAAAAAATTAGCCGGG + Intronic
1069466387 10:68643098-68643120 CAAATACAAAAAAATTAGCCAGG + Intronic
1069486023 10:68824194-68824216 AAAGTGCAAAAAAATTAGCTAGG + Intergenic
1069501695 10:68958595-68958617 AAAGTACAAAAAAATTAGCCAGG - Intronic
1070146531 10:73778017-73778039 CAAATACAAAAAAATTAGCCAGG - Intronic
1070243168 10:74703319-74703341 AAAGTACAAAAAAATTAGCCAGG + Intronic
1070294443 10:75147484-75147506 AAAATGCAAAAAAATTAGCCAGG - Intronic
1070315632 10:75309000-75309022 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1071169373 10:82845909-82845931 AAAGTGCATAAGATTAACCCTGG + Intronic
1071546270 10:86532148-86532170 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1071612991 10:87048466-87048488 AAAATACAAAAAAATTACCCGGG - Intergenic
1072354026 10:94588535-94588557 AAAATACAAAAAATTTAGCCAGG - Intronic
1072585420 10:96777519-96777541 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1072587831 10:96798386-96798408 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1072598713 10:96901927-96901949 AAAGTACAAAAAATTAGCCCAGG - Intronic
1072604166 10:96965167-96965189 AAAATGCAAAAAAATTAGCCAGG - Intronic
1072670287 10:97424490-97424512 AAAGTACAAAAAAATTAGCCGGG - Intronic
1073010907 10:100358765-100358787 AAAGTACAAAAAACTTAGCCAGG + Intronic
1073091903 10:100948723-100948745 AAAATACAAAAAAATTACCCGGG + Intronic
1073518808 10:104105281-104105303 CTTGGGCAAAAGATTTACCCAGG - Intergenic
1074124995 10:110521678-110521700 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1074477147 10:113783923-113783945 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1074828185 10:117229562-117229584 GAAGTGAAAAATATTCACCCTGG + Intergenic
1074992624 10:118723923-118723945 CAAATACAAAAAAATTACCTGGG - Intronic
1075036423 10:119072611-119072633 AAAATACAAAAAATTTAGCCGGG - Intronic
1075603181 10:123785791-123785813 AAAATACAAAAAATTTAGCCAGG - Intronic
1075688921 10:124382529-124382551 AAAATACAAAAAATTTAGCCAGG - Intergenic
1075760840 10:124855105-124855127 CAAATGAAAAAAGATTACCCAGG - Intergenic
1075763886 10:124877754-124877776 AAAATACAAAAAAATTACCCAGG + Intergenic
1076062133 10:127421075-127421097 CAAGTACAAAAAAATTAGCCGGG - Intronic
1076353059 10:129831895-129831917 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1076359231 10:129875354-129875376 CAAATGCCAAAAAATTAGCCAGG - Intronic
1076386486 10:130060661-130060683 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1076519241 10:131070057-131070079 AAAATACAAAAAATTTAGCCAGG + Intergenic
1077084882 11:744679-744701 AAAATACAAAAAATTTAGCCGGG + Intergenic
1077927580 11:6697264-6697286 AAAATACAAAAAATTTAGCCGGG - Intergenic
1078201124 11:9184190-9184212 AAAATGCAAAAAAATTAGCCGGG + Intronic
1078208269 11:9249065-9249087 CAAATACAAAAAAATTAGCCGGG + Intronic
1078209547 11:9259403-9259425 AAAGTACAAAAAAATTAGCCGGG + Intronic
1078946518 11:16074370-16074392 CAACTGCCAAAAATTGAACCAGG + Intronic
1079616031 11:22494501-22494523 AAAATACAAAAAATTTAGCCGGG - Intergenic
1079738142 11:24023584-24023606 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1079742241 11:24077273-24077295 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1079862552 11:25692385-25692407 AAAATGCAAAAAAATTAGCCTGG + Intergenic
1080321489 11:31015105-31015127 AAAGTACAAAAAAATTAGCCGGG - Intronic
1080475311 11:32584445-32584467 AAAATACAAAAAAATTACCCGGG + Intronic
1081178483 11:39958486-39958508 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1081352610 11:42072829-42072851 CAAGTGCAAAAAATTCATTATGG - Intergenic
1082117539 11:48343649-48343671 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1082176561 11:49066856-49066878 AAAATACAAAAAATTTAGCCAGG - Intergenic
1083064820 11:59913818-59913840 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1083405962 11:62457285-62457307 AAAGTACAAAAAAATTAGCCAGG + Intronic
1083438330 11:62658793-62658815 AAAGTACAAAAAAATTAGCCGGG - Intronic
1083597723 11:63926981-63927003 AAAATACAAAAAAATTACCCAGG - Intergenic
1083851931 11:65373091-65373113 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1084018587 11:66402931-66402953 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1084027441 11:66460572-66460594 CAAATACAAAAAAATTAGCCGGG - Intronic
1084034577 11:66501198-66501220 AAAGTGCAAAAAAGTTAGCCAGG + Intronic
1084082436 11:66837285-66837307 CAAATACAAAAAAATTAGCCAGG - Intronic
1084344195 11:68533542-68533564 GAAGTACAAAAAAATTAGCCAGG + Intronic
1084561406 11:69907560-69907582 AAAGTGCAAAAAAATTAGCTGGG - Intergenic
1084830325 11:71763750-71763772 AAAATGCAAAAAAATTAGCCCGG + Intergenic
1084910899 11:72388409-72388431 AAAATGCAAAAAAATTAGCCGGG - Intronic
1085577565 11:77620646-77620668 AAAATACAAAAAAATTACCCGGG + Intronic
1085600591 11:77853041-77853063 TCAGTTCTAAAAATTTACCCTGG - Intronic
1085973494 11:81623081-81623103 AAAATACAAAAAATTTAGCCGGG + Intergenic
1085984287 11:81766606-81766628 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1086056967 11:82658242-82658264 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1086076181 11:82855456-82855478 AAAATGCAAAAAACTTAGCCGGG + Intronic
1086577496 11:88356864-88356886 AAAATACAAAAAATTTAGCCGGG + Intergenic
1086689152 11:89769019-89769041 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1086693036 11:89810441-89810463 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1086712766 11:90029216-90029238 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1086748463 11:90459949-90459971 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1087235610 11:95715004-95715026 GAAGTGTAAATGATTTACCCCGG + Intergenic
1087358107 11:97121313-97121335 AAAATACAAAAAATTTAGCCGGG + Intergenic
1088031682 11:105258715-105258737 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1088454220 11:110016644-110016666 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1088640116 11:111864322-111864344 CAACTGCATAAAAGTTTCCCAGG + Intronic
1088649348 11:111943658-111943680 AAAATACAAAAAATTTAGCCAGG - Intronic
1088685478 11:112281301-112281323 AAAATGCAAAACAATTACCCAGG - Intergenic
1089259685 11:117215559-117215581 CAAATACAAAAAAATTAGCCAGG - Intronic
1089549825 11:119265035-119265057 AAAATGCAAAAAAATTAGCCAGG - Intronic
1089767773 11:120780900-120780922 AAAATGCAAAAAAATTAGCCAGG - Intronic
1089770435 11:120798638-120798660 AAAATACAAAAAAATTACCCAGG - Intronic
1089788262 11:120923571-120923593 CAAATACAAAAAAATTAGCCAGG - Intronic
1089968642 11:122674539-122674561 AAAATGCAAAAAAATTAGCCGGG - Intronic
1090011689 11:123050916-123050938 AAAATACAAAAAATTTAGCCAGG + Intergenic
1090153529 11:124411451-124411473 CCAGAGTAAAAAATTTCCCCTGG - Intergenic
1090182359 11:124711494-124711516 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1090328482 11:125909808-125909830 CAAATACAAAAAAATTAGCCAGG - Intronic
1090494409 11:127195887-127195909 CAAGTGTTAAAAACGTACCCAGG - Intergenic
1090793726 11:130115747-130115769 CTAGGGAAAAAAATTTACCTAGG - Intronic
1090841836 11:130496794-130496816 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1091523341 12:1270366-1270388 AAAATGCAAAAAAATTAGCCAGG - Intronic
1091599515 12:1909350-1909372 AAAATGCAAAAAATTTAGCCGGG - Intronic
1091756911 12:3059393-3059415 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1092136976 12:6156249-6156271 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1092600427 12:10055896-10055918 AAAATGCAAAAAAATTAGCCGGG + Intronic
1092625133 12:10318683-10318705 CAAGTACAAAAAAATTAGCCAGG + Intergenic
1092761657 12:11816403-11816425 AAAATACAAAAAATTTAGCCAGG - Intronic
1093009726 12:14093830-14093852 AAAATACAAAAAATTTAGCCAGG + Intergenic
1093264746 12:16989686-16989708 TAAATACAAAAAATTTAGCCGGG + Intergenic
1093455108 12:19357403-19357425 AAAGTACAAAAAATTTAGCCAGG - Intronic
1093486243 12:19656086-19656108 AAAATACAAAAAATTTAGCCGGG + Intronic
1093568324 12:20635259-20635281 AAAATACAAAAAAATTACCCAGG + Intronic
1093739792 12:22671676-22671698 AAAATACAAAAAATTTAGCCGGG + Intronic
1093933684 12:24979097-24979119 AAAGTGCAAAAAATTAGCCAGGG + Intergenic
1094125591 12:27019577-27019599 CAAATACAAAAAACTTACCCAGG + Intergenic
1095183047 12:39168053-39168075 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1095667613 12:44820446-44820468 AAAGTACAAAAAAATTAGCCAGG + Intronic
1095897247 12:47292259-47292281 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1096275949 12:50208323-50208345 AAAATGCAAAAAAATTAGCCAGG + Intronic
1096663129 12:53141763-53141785 AAAATACAAAAAATTTAGCCGGG + Intergenic
1096696419 12:53351769-53351791 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1097079995 12:56422944-56422966 CCAGTGCAAAAAATTTGCCCAGG + Exonic
1097163611 12:57068724-57068746 AAAATGCAAAAAAATTAGCCAGG - Intronic
1097164434 12:57075805-57075827 AAAATACAAAAAAATTACCCGGG + Intronic
1097164458 12:57075941-57075963 AAAATACAAAAAAATTACCCGGG + Intronic
1097210412 12:57364306-57364328 AAAATGCAAAAAAATTAGCCAGG - Intronic
1097982807 12:65751676-65751698 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1098022187 12:66168058-66168080 AAAGTACAAAAAAATTAGCCAGG + Intronic
1098250820 12:68568037-68568059 AAAATACAAAAAAATTACCCAGG - Intergenic
1098909161 12:76191736-76191758 AAAATACAAAAAATTTAGCCAGG + Intergenic
1098975634 12:76899215-76899237 AAAATACAAAAAATTTAGCCAGG + Intergenic
1099057807 12:77867578-77867600 AAAATGCAAAAAAATTAGCCGGG - Intronic
1099171540 12:79370600-79370622 AAAATACAAAAAATTTAGCCGGG + Intronic
1099387995 12:82041426-82041448 AAAGTACATAAAATTTACTCAGG + Intergenic
1099502153 12:83427227-83427249 CAAATGCAGAAAATTTAAACTGG - Intergenic
1099972139 12:89511262-89511284 AAAATGCAAAAAAGTTAGCCAGG + Intronic
1100243229 12:92730576-92730598 AAAGTACAAAAAAATTAGCCAGG - Intronic
1100294400 12:93247434-93247456 CAACAGAAAAAAATTTTCCCAGG + Intergenic
1100399468 12:94216105-94216127 CAAATACAAAAAAATTAGCCAGG + Intronic
1100421476 12:94438056-94438078 AAAATACAAAAAAATTACCCAGG + Intronic
1100498885 12:95154118-95154140 AAAGTACAAAAAAATTAGCCAGG - Intronic
1100510956 12:95272906-95272928 AAAATGCAAAAAAATTAGCCAGG - Intronic
1100696400 12:97098704-97098726 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1100698024 12:97116866-97116888 AAAATACAAAAAATTTAACCGGG - Intergenic
1101034291 12:100689705-100689727 AAAATACAAAAAATTTAGCCGGG - Intergenic
1101094682 12:101325237-101325259 CAAGTGCAAAGAATTTAAAGTGG - Intronic
1101333799 12:103778643-103778665 AAAATGCAAAAAATTTGACCAGG + Intronic
1101459361 12:104874232-104874254 AAAATACAAAAAAATTACCCGGG - Intronic
1101944764 12:109128307-109128329 AAAGTCCAAAAAAATTAGCCAGG - Intronic
1101985022 12:109439233-109439255 AAAATACAAAAAATTTAGCCGGG - Intronic
1102092852 12:110207721-110207743 AAAATTCAAAAAATTTAGCCAGG - Intronic
1102188697 12:110969526-110969548 GAAATGCAAAAAAATTAGCCAGG - Intergenic
1102378340 12:112441935-112441957 AAAATGCAAAAAAATTAGCCAGG - Intronic
1102397265 12:112597422-112597444 AAAATGCAAAAAAATTAGCCAGG + Intronic
1102971698 12:117173187-117173209 AAAATGCAAAAAAATTAGCCAGG - Intronic
1103507353 12:121450697-121450719 AAAATGCAAAAAAATTAGCCAGG + Intronic
1103521730 12:121540590-121540612 AAAATGCAAAAAAATTAGCCGGG + Intronic
1104083088 12:125449125-125449147 AAAATACAAAAAATTTAGCCGGG - Intronic
1104169315 12:126264761-126264783 CAAGAGCAAGACATTCACCCAGG - Intergenic
1104226343 12:126838103-126838125 CAGGTGGAGCAAATTTACCCAGG + Intergenic
1104557497 12:129814448-129814470 AAAATACAAAAAATTTACCTGGG + Intronic
1105069285 12:133224804-133224826 AAAGTACAAAAAAATTAGCCAGG + Intronic
1105362491 13:19733600-19733622 AAAATACAAAAAAATTACCCAGG + Intronic
1105515061 13:21082044-21082066 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1105900637 13:24748908-24748930 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1106058662 13:26263905-26263927 AAAGTACAAAAAAATTAGCCGGG - Intronic
1106081327 13:26502471-26502493 AAAATGCAAAAAACTTAGCCGGG + Intergenic
1106300272 13:28458093-28458115 AAAGTACAAAAAAATTAGCCAGG - Intronic
1106320442 13:28632654-28632676 AAAATGCAGAAAATTTAGCCAGG - Intergenic
1106438235 13:29742556-29742578 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1106456337 13:29930565-29930587 TAAATGCAAAAAAATTAGCCAGG - Intergenic
1106762328 13:32879473-32879495 CAAGTGGAAAAATATCACCCGGG + Intergenic
1106768464 13:32939402-32939424 AAAGTACAAAAAAATTAGCCTGG + Intergenic
1106852165 13:33805443-33805465 CAAATACAAAAAAATTAGCCAGG - Intergenic
1106934468 13:34703249-34703271 AAAATACAAAAAAATTACCCTGG - Intergenic
1107536668 13:41341990-41342012 AAAGTACAAAAAAATTAGCCGGG - Intronic
1107855729 13:44613797-44613819 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1108060043 13:46523819-46523841 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1108548191 13:51517580-51517602 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1108867888 13:54943109-54943131 AAAATACAAAAAATTTAGCCAGG - Intergenic
1108915380 13:55604381-55604403 AAAATACAAAAAATTTAGCCAGG + Intergenic
1109224015 13:59670741-59670763 AAAATGCAAAAAAATTAGCCGGG - Intronic
1109485930 13:63019395-63019417 CATATGCAAAAAATTTATCTGGG + Intergenic
1109642708 13:65211267-65211289 CAAATACAAAAAAGTTAGCCAGG - Intergenic
1109816867 13:67596134-67596156 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1110388013 13:74937227-74937249 AAAATACAAAAAATTTAGCCAGG + Intergenic
1110415660 13:75249335-75249357 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1110592868 13:77285218-77285240 CCTGTGTAAAAAATTTACCCAGG + Intronic
1110800396 13:79687323-79687345 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1110938095 13:81317944-81317966 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1111124623 13:83898256-83898278 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1111154727 13:84307872-84307894 AAAATGCAAAAAATTTAGCCGGG + Intergenic
1111216929 13:85155977-85155999 AAAATACAAAAAAATTACCCAGG - Intergenic
1111567528 13:90035185-90035207 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1111660128 13:91199441-91199463 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1111768580 13:92567163-92567185 CCAGTGCTAAAAATTTCCCGAGG + Intronic
1111772492 13:92615891-92615913 AAAGTACAAAAAAATTAGCCGGG + Intronic
1111784672 13:92771501-92771523 AAAATGCAAAAAAATTAGCCGGG - Intronic
1111872170 13:93846651-93846673 AAAGTACAAAAAAATTAGCCAGG + Intronic
1111997953 13:95183751-95183773 AAAGTACAAAAAAATTAGCCAGG + Intronic
1112285028 13:98096535-98096557 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1112289517 13:98132841-98132863 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1112419428 13:99234346-99234368 AAAATACAAAAAAATTACCCGGG - Intronic
1112471328 13:99692450-99692472 AAAGTTCAAAAAAATTAACCGGG - Intronic
1112632993 13:101181971-101181993 AAAGTACAAAAAAATTAGCCGGG + Intronic
1112735891 13:102416604-102416626 AAAATACAAAAAATTTAGCCGGG + Intergenic
1113392596 13:109911701-109911723 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1113441004 13:110327793-110327815 CAAGTGCTAAGACTTCACCCAGG - Intronic
1113830488 13:113291679-113291701 AAAATACAAAAAATTTAGCCGGG + Intergenic
1113985156 13:114308873-114308895 AAAATACAAAAAATTTAGCCAGG - Intergenic
1114162861 14:20188535-20188557 CATGTGCAAAAAATTGAAACTGG + Intergenic
1114677202 14:24450507-24450529 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1114717722 14:24845170-24845192 AAAGTACAAAAAAATTAGCCAGG - Intronic
1115193900 14:30775897-30775919 CAAAAACAAAAAATTTAGCCAGG + Intergenic
1115454133 14:33581730-33581752 AAAGTACAAAAAAATTATCCAGG - Intronic
1115510714 14:34135537-34135559 AAAGTACAAAAAAATTAGCCGGG - Intronic
1115570195 14:34659182-34659204 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1115682577 14:35758089-35758111 AAAATACAAAAAATTTAGCCTGG + Intronic
1115865290 14:37740001-37740023 AAAATACAAAAAAATTACCCAGG + Intronic
1115956338 14:38784173-38784195 TAAATACAAAAAAATTACCCGGG + Intergenic
1115989836 14:39140606-39140628 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1115994072 14:39177223-39177245 AAAGTACAAAAAAGTTACCCAGG + Intronic
1116044443 14:39726783-39726805 GACTTGCAAAAAATTTACCTTGG - Intergenic
1116143557 14:41033495-41033517 AAAATACAAAAAAGTTACCCAGG - Intergenic
1116198901 14:41765179-41765201 AAAGTACAAAAAAATTAGCCGGG + Intronic
1116261480 14:42633957-42633979 AAATTGCAACAAATTTAACCAGG + Intergenic
1116801114 14:49443943-49443965 AAAGTACAAAAAAATTAGCCTGG - Intergenic
1116818522 14:49605054-49605076 CCAGTACAAAAAAATTAGCCTGG - Intronic
1117385020 14:55202846-55202868 AAAGTGCAAAAAACTTAGTCAGG + Intergenic
1117704549 14:58451147-58451169 AAAATACAAAAAATTTAACCAGG - Intronic
1117960897 14:61160416-61160438 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1118205320 14:63717480-63717502 AAAATGCAAAAAAATTAGCCGGG - Intronic
1118584488 14:67339939-67339961 AAAGTACAAAAAAATTATCCAGG + Intronic
1118682131 14:68252920-68252942 AAAGTACAAAAAAATTAGCCAGG + Intronic
1118769587 14:68933292-68933314 AAAATACAAAAAAATTACCCAGG - Intronic
1118854857 14:69612541-69612563 GAAGTGGAGAAAAGTTACCCTGG + Intronic
1118969263 14:70619295-70619317 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1119009006 14:70964225-70964247 AAAATGCAAAAAAATTAGCCAGG - Intronic
1119271346 14:73307891-73307913 AAAATGCAAAAAAATTAGCCGGG - Intronic
1119308717 14:73628892-73628914 AAAATACAAAAAAGTTACCCGGG + Intergenic
1119412851 14:74445633-74445655 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1119461156 14:74805178-74805200 AAAATACAAAAAATTTAGCCAGG - Intronic
1119517047 14:75256689-75256711 AAAATACAAAAAATTTAGCCGGG - Intronic
1119762829 14:77164584-77164606 AAAATGCAAAAAAATTAGCCGGG - Intronic
1119992674 14:79216974-79216996 AAAGTACAAAAAAATTAGCCAGG + Intronic
1120165976 14:81200464-81200486 AAAGTACAAAAAAATTAGCCAGG + Intronic
1120289320 14:82546614-82546636 GAATTGCAAAAACTTTACCATGG + Intergenic
1120320074 14:82948253-82948275 AAAATACAAAAAATTTAGCCGGG + Intergenic
1120525718 14:85574896-85574918 CCTTTGGAAAAAATTTACCCAGG + Intronic
1120530033 14:85621288-85621310 CATGTGCAAAAAATTCAACAGGG - Exonic
1120531108 14:85632309-85632331 AAAATACAAAAAATTTAGCCGGG + Exonic
1120863033 14:89272149-89272171 AAAATACAAAAAAATTACCCGGG + Intronic
1121048618 14:90805422-90805444 AAAGTACAAAAAAATTAGCCGGG - Intronic
1121055771 14:90851196-90851218 AAAGTACAAAAAAATTAGCCAGG - Exonic
1121146061 14:91583256-91583278 AAAATACAAAAAATTTAGCCAGG + Intronic
1121146258 14:91585175-91585197 CAAATACAAAAAAATTAGCCAGG - Intronic
1121354411 14:93201764-93201786 CAAATACAAAAAAATTAGCCAGG + Intronic
1121634395 14:95443805-95443827 AAAAAGCAAAAAATTTAGCCAGG - Intronic
1122760865 14:104025140-104025162 CAAAAGCACAAAAATTACCCGGG - Intronic
1123720716 15:23059446-23059468 AAAATGCAAAAAAATTATCCAGG + Intergenic
1123814643 15:23964615-23964637 AAAATACAAAAAAATTACCCGGG - Intergenic
1123900479 15:24871863-24871885 AAAGTACAAAAAAATTAGCCAGG - Intronic
1124029133 15:25993592-25993614 CATGTGCAAAAAATATTCCCTGG - Intergenic
1124082848 15:26517378-26517400 AAAATACAAAAAATTTAGCCGGG - Intergenic
1124140002 15:27068803-27068825 AAAGTGAAAAACATTTACCTGGG + Intronic
1124443563 15:29708033-29708055 AAAATACAAAAAATTTAGCCAGG + Intronic
1124471201 15:29987584-29987606 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1124921471 15:34030775-34030797 CAACAACAAAAAATTTAGCCAGG - Intronic
1124932610 15:34136865-34136887 AAAATACAAAAAAATTACCCGGG + Intergenic
1125024660 15:35018630-35018652 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1125292680 15:38167028-38167050 CAACAACAAAAAATTTAGCCAGG + Intergenic
1125668205 15:41449389-41449411 AAAATGCAAAAAAATTAGCCGGG - Intronic
1125887033 15:43236806-43236828 AAAATACAAAAAATTTAGCCAGG + Intronic
1125896645 15:43308108-43308130 CAAATACAAAAAAATTAGCCGGG - Intergenic
1125952717 15:43767189-43767211 AAAATGCAAAAAAATTAGCCAGG + Intronic
1126059154 15:44762124-44762146 AAAATGCAAAAAAATTAGCCGGG - Intronic
1126611120 15:50530421-50530443 AAAATGCAAAAAAATTAGCCGGG + Intronic
1126622930 15:50658163-50658185 AAAATGCAAAAAAATTAGCCGGG - Intronic
1126649275 15:50905655-50905677 AAAATACAAAAAATTTAGCCGGG - Intergenic
1126760108 15:51962001-51962023 AAAATACAAAAAATTTAGCCAGG + Intronic
1126817952 15:52472237-52472259 AAAGTACAAAAAAATTAGCCGGG - Intronic
1126980387 15:54235981-54236003 TAAATGCAAAAAATTGACCATGG + Intronic
1127399645 15:58573204-58573226 AAAGTCCAAAATAATTACCCTGG + Intergenic
1127433745 15:58936372-58936394 AAAATGCAAAAAAATTAGCCAGG - Intronic
1127753893 15:62071400-62071422 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1128174602 15:65544014-65544036 AAAATACAAAAAAATTACCCGGG + Intronic
1128205411 15:65847320-65847342 CAAATACAAAAAAATTAGCCGGG + Intronic
1128462106 15:67878177-67878199 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1128858311 15:71040657-71040679 AAAATGCAAAAAAATTAGCCGGG + Intronic
1128858921 15:71048246-71048268 CAAGAATAAAAAATTTAGCCAGG - Intronic
1128954346 15:71924400-71924422 AAAATACAAAAAATTTAGCCAGG - Intronic
1129766347 15:78171439-78171461 CAAGAGCAAAAAATGTAATCAGG - Exonic
1129808755 15:78488625-78488647 CATGTTCAAAAATTTTAACCAGG + Exonic
1130018309 15:80204000-80204022 AAAGTACAAAAAGTTTAGCCGGG + Intergenic
1130665507 15:85866083-85866105 CAAATACAAAAAAATTAGCCAGG - Intergenic
1131128724 15:89879764-89879786 AAAATGCAAAAAAATTAGCCAGG - Intronic
1131209779 15:90484667-90484689 AAAATTCAAAAAATTTAGCCAGG - Intronic
1131216189 15:90537542-90537564 AAAGTACAAAAAAATTAGCCAGG - Intronic
1131594291 15:93781246-93781268 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1131776026 15:95799590-95799612 CAAGTGCAGAAAAATTATCAGGG - Intergenic
1131776216 15:95802032-95802054 CAAGTGCAGAAAAATTATCAGGG - Intergenic
1132182010 15:99762269-99762291 CCAGTGCTAAAAATTTCCCGAGG - Intergenic
1132204997 15:99980437-99980459 CTACTGCAAAACATGTACCCAGG + Intronic
1132258937 15:100403906-100403928 CATCTGCAAAAACTTTACACAGG - Intronic
1132423086 15:101691097-101691119 AAAATGCAAAAAAATTAGCCAGG - Intronic
1132477223 16:146306-146328 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1132487769 16:204431-204453 AAAGTACAAAAAAATTAGCCGGG + Intronic
1132652984 16:1029889-1029911 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1132730591 16:1359427-1359449 AAAGTACAAAAAAATTAGCCAGG - Intronic
1132755771 16:1484422-1484444 AAAATACAAAAAATTTAGCCAGG - Intergenic
1132867552 16:2101144-2101166 AAAGTACAAAAAAATTAGCCCGG - Intronic
1132894340 16:2221002-2221024 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1132895519 16:2227530-2227552 AAAATGCAAAAAACTTAGCCAGG - Intronic
1133107913 16:3525723-3525745 CAAATTTAAAAAATTTAGCCAGG - Intronic
1133182670 16:4069935-4069957 AAAGTACAAAAAAATTAGCCAGG + Intronic
1133190325 16:4129032-4129054 AAAATACAAAAAATTTAGCCAGG - Intergenic
1133279732 16:4658373-4658395 AAAATACAAAAAAATTACCCGGG + Intronic
1134479077 16:14602089-14602111 AAAGTGCAAAAAAATTAGCCGGG - Intronic
1134558285 16:15185160-15185182 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1134618336 16:15669058-15669080 AAAATACAAAAAATTTAGCCAGG - Intronic
1134816085 16:17207216-17207238 AAAATACAAAAAATTTAGCCAGG - Intronic
1134918817 16:18096763-18096785 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1135038390 16:19097565-19097587 GAAGAGAAAAAAATTTGCCCAGG + Intergenic
1135122277 16:19776544-19776566 AAAATACAAAAAAATTACCCAGG + Intronic
1135132697 16:19866085-19866107 GAAGTACAAAAAAATTAGCCGGG - Intronic
1135700325 16:24626808-24626830 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1135787961 16:25367332-25367354 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1136080116 16:27846794-27846816 AAAATACAAAAAAATTACCCGGG + Intronic
1136225722 16:28859100-28859122 CAAATACAAAAAAATTAGCCAGG - Intronic
1136226263 16:28862774-28862796 AAAATACAAAAAATTTAGCCGGG - Intronic
1136231695 16:28889415-28889437 CAAATGCAAAAAAATTAGCCAGG - Intronic
1136404683 16:30037380-30037402 AAAATACAAAAAATTTAGCCAGG + Intronic
1136506264 16:30705558-30705580 AAAATACAAAAAATTTAGCCGGG - Intronic
1136542195 16:30934201-30934223 GAAATACAAAAAATTTAGCCAGG + Intronic
1136643621 16:31589425-31589447 CAAGTGCAAGGACTTTACACTGG + Intergenic
1137288288 16:47034218-47034240 AAAGTACAAAAAACTTACCGGGG - Intergenic
1137452017 16:48585090-48585112 AAAGTACAAAAAAATTAGCCAGG - Intronic
1137579429 16:49624390-49624412 AAAGTACAAAAAAATTAGCCAGG + Intronic
1137620399 16:49872758-49872780 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1137821791 16:51452992-51453014 CAAGTGCAGATAATTTATCTGGG - Intergenic
1137864912 16:51883704-51883726 AAAATACAAAAAATTTAGCCGGG + Intergenic
1138021276 16:53483730-53483752 AAAGTACAAAAAAATTAGCCGGG + Intronic
1138109800 16:54314593-54314615 AAAATACAAAAAATTTAGCCGGG - Intergenic
1138176665 16:54906120-54906142 CAAATTTAAAAAATTTAACCAGG + Intergenic
1138213410 16:55181775-55181797 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1138435472 16:56997028-56997050 AAAATGCAAAAAAATTAGCCTGG - Intronic
1138571637 16:57877804-57877826 AAAATACAAAAAAATTACCCGGG - Intergenic
1138668651 16:58594952-58594974 AAAATACAAAAAAATTACCCGGG + Intronic
1138695054 16:58805143-58805165 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1138772582 16:59683483-59683505 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1138823296 16:60287442-60287464 ACAGTACAAAAAATTTAGCCAGG + Intergenic
1138977147 16:62221280-62221302 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1139055792 16:63181687-63181709 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1139324972 16:66145620-66145642 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1139476510 16:67205316-67205338 TAAATACAAAAAATTTAGCCAGG - Intergenic
1139513395 16:67439856-67439878 AAAATACAAAAAATTTAGCCAGG + Intronic
1139555506 16:67706896-67706918 AAAATGCAAAAAAATTAGCCAGG + Intronic
1139710586 16:68772783-68772805 AAAGTACAAAAAAATTACCTGGG + Intronic
1139738783 16:69016818-69016840 AAAATACAAAAAATTTAGCCAGG - Intronic
1139769173 16:69259391-69259413 AAAATACAAAAAATTTAGCCGGG - Intronic
1139773462 16:69297751-69297773 AAAATGCAAAAAAATTAGCCGGG + Intronic
1140107815 16:71976901-71976923 AAAATGCAAAAAAATTAGCCAGG - Intronic
1140108827 16:71985725-71985747 AAAGTTCAAAAAAATTAGCCAGG - Intronic
1140188585 16:72795676-72795698 CCAGTGCAAAAAATGTAGCCTGG - Exonic
1140607018 16:76551250-76551272 AAAATACAAAAAATTTAGCCAGG + Intronic
1140668640 16:77251701-77251723 CAAGTGTAGAAAATGTACACTGG + Intronic
1140897657 16:79339228-79339250 AAAATACAAAAAATTTAGCCGGG - Intergenic
1140917495 16:79507272-79507294 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1141041091 16:80673157-80673179 AAAGTACAAAAAAATTAGCCGGG + Intronic
1141073440 16:80979779-80979801 AAAGTACAAAAAAATTAGCCAGG - Intronic
1141437465 16:84008541-84008563 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1141492362 16:84382733-84382755 AAAATGCAAAACATTTAGCCAGG + Intronic
1142075018 16:88112936-88112958 AAAATGCAAAAAAATTAGCCAGG - Intronic
1142300542 16:89255385-89255407 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1142357181 16:89606854-89606876 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1142404071 16:89876766-89876788 GAAGTACAAAAAAATTAGCCGGG + Intronic
1142422322 16:89979444-89979466 AAAATACAAAAAAATTACCCGGG - Intergenic
1142562293 17:817507-817529 AAAATACAAAAAATTTAGCCGGG + Intronic
1142562458 17:818723-818745 AAAATACAAAAAATTTAGCCGGG + Intronic
1142700536 17:1657483-1657505 AAAATACAAAAAATTTAGCCGGG + Intronic
1142734852 17:1890500-1890522 AAAGTACAAAAAAATTAGCCAGG + Intronic
1142877484 17:2860762-2860784 AAAATACAAAAAAATTACCCAGG - Intronic
1143063751 17:4225919-4225941 AAAATGCAAAAAAATTAGCCAGG - Intronic
1143070083 17:4284438-4284460 AAAATACAAAAAATTTAGCCAGG + Intronic
1143072123 17:4305111-4305133 AAAATACAAAAAATTTAGCCAGG - Intronic
1143122674 17:4618611-4618633 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1143193264 17:5056065-5056087 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1143450523 17:7034025-7034047 AAAATACAAAAAATTTAGCCAGG + Intergenic
1143493771 17:7298934-7298956 AAAGTTCAAAAAAATTATCCGGG - Intergenic
1143782256 17:9235121-9235143 CAAATACAAAAAAATTAGCCAGG - Intronic
1144348437 17:14371097-14371119 AAAATACAAAAAATTTAGCCAGG - Intergenic
1144491016 17:15709329-15709351 CAAATACAAAAAAATTAGCCGGG + Intronic
1144492804 17:15729283-15729305 CAAATACAAAAAAATTACCTGGG + Intergenic
1144547686 17:16213330-16213352 AAAGTACAAAAAAATTAGCCAGG + Intronic
1144579773 17:16451903-16451925 AAAATGCAAAAAAATTAGCCGGG - Intronic
1144805397 17:17962798-17962820 AAATTGCAAAAAATTTAGCTGGG + Intronic
1144910390 17:18676859-18676881 CAAATACAAAAAAATTAGCCGGG - Intronic
1144936718 17:18905182-18905204 AAAATACAAAAAAATTACCCAGG - Intronic
1144992845 17:19245821-19245843 AAAATACAAAAAAATTACCCAGG - Intronic
1145084621 17:19926960-19926982 AAAATGCAAAAAAATTAGCCAGG + Intronic
1145372370 17:22317622-22317644 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1145926118 17:28648060-28648082 AAAATACAAAAAAATTACCCTGG + Intergenic
1145938672 17:28729514-28729536 AAAATCCAAAAAATTTAGCCGGG - Intronic
1146049324 17:29536437-29536459 AAAATACAAAAAATTAACCCGGG + Intronic
1146208417 17:30923423-30923445 TAAGTACAAAAAAATTAGCCGGG - Intronic
1146230938 17:31108432-31108454 AAAATACAAAAAATTTAGCCAGG - Intronic
1146393174 17:32441705-32441727 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1146782247 17:35684859-35684881 TAAGAGCAGAAAATTTGCCCTGG - Intronic
1146899324 17:36571680-36571702 AAAATACAAAAAATTTAGCCGGG + Intronic
1147111496 17:38265223-38265245 GAAATGCAAAAAAATTAGCCGGG + Intergenic
1147168023 17:38603670-38603692 CAAGTGCAAAGGCTTTGCCCTGG - Intronic
1147307321 17:39573192-39573214 AAAGTCCAAAAAAATTAACCGGG + Intergenic
1147369732 17:39984037-39984059 AAAATACAAAAAATTTAGCCAGG + Intronic
1147753275 17:42750590-42750612 AAAATACAAAAAATTTAGCCAGG - Intergenic
1147811469 17:43172984-43173006 AAAATACAAAAAATTTAGCCAGG - Intronic
1147814555 17:43199533-43199555 AAAATACAAAAAAATTACCCGGG - Intronic
1147833256 17:43312016-43312038 CAAGTGTAAAAATATTACTCTGG + Intergenic
1147867311 17:43561579-43561601 CACATGCAAAACATTTAGCCTGG - Intronic
1148029030 17:44607455-44607477 AAAATACAAAAAATTTAGCCAGG + Intergenic
1148066126 17:44871497-44871519 AAAATGCAAAAAAATTAGCCAGG - Intronic
1148074772 17:44928890-44928912 CAAGAGGAAAAAATTGAGCCTGG - Exonic
1148097492 17:45063042-45063064 AAAATACAAAAAATTTAGCCGGG + Intronic
1148182239 17:45614501-45614523 AAAATACAAAAAATTTAGCCGGG + Intergenic
1148650131 17:49244519-49244541 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1148937403 17:51174607-51174629 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1148994649 17:51699160-51699182 AAAATACAAAAAAATTACCCAGG + Intronic
1149501720 17:57157793-57157815 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1149609576 17:57950309-57950331 AAAGTACAAAAAAATTATCCAGG - Intronic
1149788102 17:59453528-59453550 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1149809517 17:59654334-59654356 AAAATACAAAAAAATTACCCAGG - Intronic
1149946992 17:60939270-60939292 AAAATACAAAAAATTTAGCCAGG + Intronic
1150028035 17:61698873-61698895 AAAGTACAAAAAAATTAGCCAGG - Intronic
1150064414 17:62096938-62096960 CAAATACAAAAAAATTAGCCGGG - Intergenic
1150255765 17:63742767-63742789 AAAGTACAAAAAAATTAGCCGGG + Intronic
1150423390 17:65057434-65057456 TAAATACAAAAAATTTAGCCGGG - Intergenic
1150440658 17:65188771-65188793 AAAGTACAAAAAAATTAGCCAGG - Intronic
1150642506 17:66959006-66959028 CAAATACAAAAAAGTTAACCAGG - Intergenic
1150725834 17:67650607-67650629 AAAATCCAAAAAATTTAGCCAGG - Intronic
1150889440 17:69130154-69130176 AAAATGCAAAAAAATTAGCCAGG + Intronic
1150956102 17:69862319-69862341 AAAATACAAAAAATTTAGCCAGG + Intergenic
1151093252 17:71466572-71466594 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1151501483 17:74492641-74492663 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1151526653 17:74674233-74674255 CAACTGCCAAAAAATTAGCCAGG - Intronic
1151644931 17:75424023-75424045 CAAATACAAAAAAATTAGCCAGG + Intergenic
1151787823 17:76284005-76284027 AAAATACAAAAAAATTACCCAGG + Intronic
1151795562 17:76342917-76342939 AAAATACAAAAAAATTACCCGGG + Intronic
1151813678 17:76460308-76460330 AAAATACAAAAAAATTACCCAGG - Intronic
1151862135 17:76772262-76772284 AAAGTACAAAAAAATTAGCCAGG + Intronic
1152061456 17:78078930-78078952 AAAATACAAAAAATTTAGCCGGG + Intronic
1152131735 17:78481261-78481283 AAAGTACAAAAAAATTAGCCAGG - Intronic
1152346457 17:79755308-79755330 AAAGTACAAAAAAGTTAGCCGGG + Intergenic
1152452615 17:80391925-80391947 AAAGTACAAAAAAATTAGCCGGG - Intronic
1153053999 18:927766-927788 AAAATACAAAAAAATTACCCAGG + Intergenic
1153160280 18:2197216-2197238 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1153202888 18:2663873-2663895 AAAGTACAAAAAAATTAGCCAGG - Intronic
1153269693 18:3307864-3307886 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1153442056 18:5131777-5131799 AAAATACAAAAAATTTAGCCAGG + Intergenic
1154073659 18:11178335-11178357 GAAATGCAAAAAAATTAGCCGGG - Intergenic
1154093062 18:11382809-11382831 CAAATGTAATAAATTTACCATGG - Intergenic
1154301282 18:13194838-13194860 AAAATACAAAAAATTTAGCCAGG + Intergenic
1154947607 18:21177677-21177699 AAAGTAGAAAAAATTTAGCCAGG + Intergenic
1155158106 18:23174630-23174652 AAAATGCAAAAAAATTAGCCGGG - Intronic
1155163683 18:23215912-23215934 AAAATACAAAAAATTTAGCCTGG - Intronic
1155295474 18:24380789-24380811 TAAATGCAAAAAAATTAGCCAGG + Intronic
1155413197 18:25568750-25568772 AAAATACAAAAAATTTAGCCAGG + Intergenic
1155552028 18:26974832-26974854 AAAATACAAAAAATTTAGCCGGG - Intronic
1155658559 18:28220652-28220674 AAAATACAAAAAATTTAGCCAGG + Intergenic
1156141690 18:34119780-34119802 AAAGTACAAAAAAATTAGCCAGG - Intronic
1156570001 18:38242411-38242433 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1157055690 18:44225910-44225932 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1157247610 18:46068456-46068478 AAAATACAAAAAAATTACCCGGG - Intronic
1158415125 18:57243594-57243616 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1158459779 18:57635981-57636003 AAAGTACAAAAATATTACCCAGG - Intergenic
1158512414 18:58102398-58102420 AAAGTGAACAAAATTGACCCTGG + Intronic
1158651506 18:59291997-59292019 AAAATACAAAAAATTTACCTGGG - Intronic
1159974627 18:74695382-74695404 CAAGTGCTAAAAATACACTCTGG + Intronic
1160036787 18:75309330-75309352 CAAGTGCAGAAAATGTATCAAGG - Intergenic
1160193619 18:76735356-76735378 AAAATGCAAAAAATTTAGCTGGG + Intergenic
1160372890 18:78389510-78389532 AAAATACAAAAAAATTACCCGGG - Intergenic
1160761609 19:788233-788255 AAAATACAAAAAAATTACCCGGG - Intergenic
1160913290 19:1484649-1484671 AAAATACAAAAAAATTACCCGGG + Intronic
1161161916 19:2766591-2766613 AAAATGCAAAAAAATTAGCCAGG - Intronic
1161179409 19:2869525-2869547 AAAGTACAAAAAAATTAGCCAGG - Intronic
1161264156 19:3356107-3356129 AAAATACAAAAAATTTAGCCAGG - Intergenic
1161311881 19:3599488-3599510 AAAATGCAAAAAAATTAGCCAGG - Intronic
1161358453 19:3832794-3832816 AAAATGCAAAAAAATTAGCCAGG - Intronic
1161430142 19:4226876-4226898 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1161463824 19:4416011-4416033 AAAATACAAAAAAATTACCCAGG + Intronic
1161617461 19:5279841-5279863 AAAATGCAAAAAAATTAGCCAGG - Intronic
1161746833 19:6065484-6065506 CAAATACAAAAAAATTAGCCGGG + Intronic
1161969465 19:7568880-7568902 AAAATACAAAAAATTTAGCCGGG + Intergenic
1162122553 19:8480504-8480526 CAAACACAAAAAATTTAGCCGGG + Intronic
1162151920 19:8652261-8652283 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1162200107 19:9013711-9013733 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1162202249 19:9029114-9029136 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1162260316 19:9528144-9528166 AAAATACAAAAAATTTAGCCAGG - Exonic
1162276259 19:9657705-9657727 AAAATGCAAAAAAATTAGCCAGG - Intronic
1162401096 19:10447057-10447079 AAAATGCAAAAAAATTAGCCAGG - Intronic
1162414736 19:10528670-10528692 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1162418288 19:10551537-10551559 AAAATACAAAAAATTAACCCGGG + Intronic
1162436530 19:10663364-10663386 AAAATGCAAAAAAATTAGCCAGG - Intronic
1162556903 19:11392682-11392704 AAAATGCAAAAAAATTAGCCGGG - Intronic
1162644650 19:12040001-12040023 AAAGTACAAAAAAATTAGCCAGG + Intronic
1162665742 19:12210275-12210297 AAACTGCAAAAAAATTAGCCGGG - Intergenic
1162699032 19:12499918-12499940 AAAATACAAAAAATTTAGCCAGG - Intronic
1162719550 19:12654201-12654223 AAAATACAAAAAATTTAGCCAGG - Intronic
1162772828 19:12960081-12960103 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1163079222 19:14924909-14924931 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1163229238 19:15988913-15988935 AAACTACAAAAAATTTAGCCGGG - Intergenic
1163341379 19:16709684-16709706 AAAATACAAAAAATTTAGCCAGG - Intergenic
1163359821 19:16838830-16838852 AAAATGCAAAAAAATTAGCCAGG - Intronic
1163662016 19:18583896-18583918 AAAATACAAAAAATTTAGCCGGG + Intronic
1163752974 19:19089365-19089387 AAAGTACAAAAAAGTTAGCCAGG + Intronic
1163755470 19:19104065-19104087 AAAGTACAAAAAAATTAGCCAGG - Intronic
1163870396 19:19816516-19816538 CAAATACAAAAAAATTAGCCAGG - Intronic
1163926803 19:20353691-20353713 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1164079901 19:21853037-21853059 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1164124887 19:22304197-22304219 CAAATACAAAAAAATTAGCCGGG - Intronic
1164269453 19:23658198-23658220 AAAATGCAAAAAAATTAGCCAGG + Intronic
1164662520 19:29989269-29989291 AAAGTACAAAAAAATTAGCCGGG - Intronic
1164666193 19:30039435-30039457 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1164959362 19:32414258-32414280 AAAATACAAAAAAATTACCCGGG + Intronic
1165055330 19:33172929-33172951 CAAATACAAAAAAATTAGCCAGG + Intronic
1165133762 19:33650690-33650712 CAAAAGCAAAAAAATTAACCAGG - Intronic
1165140486 19:33697001-33697023 AAAATACAAAAAATTTAGCCAGG - Intronic
1165180658 19:33964620-33964642 CAAATACAAAAAAATTACCTGGG - Intergenic
1165185589 19:34018189-34018211 AAAATACAAAAAATTTAGCCAGG + Intergenic
1165246066 19:34499052-34499074 CAAGGGGAAAAAAATTAGCCGGG + Intronic
1165415305 19:35689766-35689788 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1165545273 19:36529785-36529807 CAACAACAAAAAAATTACCCGGG - Intergenic
1165614450 19:37187160-37187182 CAAGATCAAAAAATTTATTCTGG - Exonic
1165799711 19:38541553-38541575 AAAATGCAAAAAAATTAGCCGGG + Intronic
1165942400 19:39421525-39421547 AAAGTACAAAAAAATTAGCCAGG + Intronic
1166038044 19:40183652-40183674 AAAGTGTCAAAAATTTATCCCGG + Intergenic
1166257398 19:41616188-41616210 AAAATACAAAAAATTTAGCCGGG - Intronic
1166323697 19:42036218-42036240 AAAGTACAAAAAAATTAGCCAGG - Intronic
1166379546 19:42348758-42348780 AAAATGCAAAAAAATTAGCCAGG - Intronic
1166428672 19:42702798-42702820 AAAATACAAAAAAATTACCCGGG - Intronic
1166559477 19:43722577-43722599 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1166747222 19:45147069-45147091 CAAGTGCAATAAATCTATCAGGG + Exonic
1167121420 19:47519562-47519584 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1167122242 19:47524545-47524567 AAAATACAAAAAATTTAGCCGGG + Intronic
1167150874 19:47708851-47708873 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1167450821 19:49567830-49567852 AAAATGCAAAAAAATTAGCCGGG - Intronic
1167562458 19:50233976-50233998 AAAGTACAAAAAAATTAGCCGGG - Intronic
1167624241 19:50576745-50576767 CAAAAGAAAAAAAATTACCCAGG - Intergenic
1167680698 19:50918449-50918471 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1167782687 19:51610061-51610083 AAAGTACAAAAAATTTAGCCAGG - Intergenic
1167884596 19:52489814-52489836 AAAGTACAAAAAAATTAGCCGGG - Intronic
1168173347 19:54605970-54605992 AAAATGCAAAAAAATTAGCCAGG + Intronic
1168528622 19:57107506-57107528 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1168550538 19:57289843-57289865 AAAATACAAAAAATTTAGCCAGG + Intronic
1168577208 19:57522428-57522450 AAAATACAAAAAATTTAGCCGGG + Intergenic
1168648596 19:58078004-58078026 CAAATACAAAAAAATTACCTAGG - Intronic
1168653942 19:58113153-58113175 AAAATGCAAAAAAATTAGCCAGG + Intronic
1168693526 19:58392161-58392183 AAAGTACAAAAAATTTAGCTGGG + Intronic
1168708258 19:58481952-58481974 AAAATGCAAAAAAATTAGCCGGG - Intronic
1202685245 1_KI270712v1_random:43401-43423 AAAATGCAAAAAAATTAGCCGGG + Intergenic
925014677 2:513677-513699 AAAGTACAAAAAAATTAGCCAGG + Intergenic
925193479 2:1904527-1904549 AAAATGCAAAAAAATTAGCCAGG - Intronic
925216397 2:2099493-2099515 CAAGTGCTGAAAATTTTCTCTGG - Intronic
925567609 2:5273140-5273162 AAAGTACAAAAAAATTAGCCGGG - Intergenic
925952881 2:8931782-8931804 CATGTGCAAAAAATTGAATCTGG - Intronic
926081422 2:9989707-9989729 AAAATACAAAAAATTTAGCCGGG - Intronic
926730576 2:16032968-16032990 AAAATGCAAAAAATTAACCCAGG - Intergenic
927117488 2:19919218-19919240 AAAATACAAAAAATTTAGCCAGG + Intronic
927525281 2:23734315-23734337 AAAATGCAAAAAAATTAGCCAGG - Intergenic
927569543 2:24145847-24145869 AAAATACAAAAAATTTAGCCAGG - Intronic
927616913 2:24607527-24607549 AAAATACAAAAAATTTAGCCGGG + Intronic
927830307 2:26344670-26344692 AAAATGCAAAAAATTTAGCCGGG + Intronic
927992139 2:27455548-27455570 AAAGTACAAAAAAATTAGCCGGG + Intronic
928056232 2:28057981-28058003 AAAATGCAAAAAAATTAACCGGG + Intronic
928515682 2:32042917-32042939 AAAATACAAAAAAATTACCCGGG - Intergenic
928666152 2:33552238-33552260 CAAGGGCAAAACTTTAACCCAGG - Intronic
928694805 2:33838609-33838631 AAAATACAAAAAAATTACCCAGG + Intergenic
928775229 2:34753166-34753188 TTGGTGCAAAAAATCTACCCAGG + Intergenic
928960735 2:36923288-36923310 AAAATGCAAAAAAATTAGCCAGG + Intronic
928961805 2:36933949-36933971 AAAATACAAAAAAATTACCCGGG + Intronic
928981668 2:37142289-37142311 AAAATACAAAAAAATTACCCAGG - Intronic
929258726 2:39841266-39841288 AAAATGCAAAAAAATTAGCCGGG - Intergenic
929275019 2:40015631-40015653 AAAATACAAAAAAATTACCCGGG + Intergenic
929467265 2:42156272-42156294 AAAGTACAAAAAAATTAGCCGGG - Intergenic
929469510 2:42177460-42177482 AAAGTACAAAAAAATTAGCCAGG + Intronic
929570104 2:43017446-43017468 AAAATGCAAAAAAGTTATCCGGG - Intergenic
929633338 2:43489464-43489486 CAAGGTACAAAAATTTACCCAGG + Intronic
929709410 2:44251025-44251047 CAAATACAAAAAAATTAGCCAGG - Intergenic
930004958 2:46889317-46889339 AAAATGCAAAAAAATTAGCCGGG + Intergenic
930084211 2:47481658-47481680 AAAATACAAAAAATTTAGCCGGG - Intronic
930123097 2:47775925-47775947 CAAGTGCAAAAAATTTACCCAGG + Intronic
930254034 2:49068506-49068528 GGAGAACAAAAAATTTACCCAGG + Intronic
930445652 2:51468317-51468339 AAAATGCAAAAAAATTAGCCGGG - Intergenic
930449290 2:51514292-51514314 AAAATGCAAAAAAATTAGCCAGG - Intergenic
930538983 2:52680841-52680863 AAAATGCAAAAAAATTAGCCAGG - Intergenic
930579433 2:53192577-53192599 CAACTTCAAAATATTTCCCCAGG + Intergenic
930624549 2:53681997-53682019 AAAGTACAAAAAAATTAGCCAGG + Intronic
930781234 2:55226029-55226051 AAAGTACAAAAAAATTAGCCGGG + Intronic
930805518 2:55485476-55485498 AAAATACAAAAAATTTAGCCGGG + Intergenic
930827801 2:55711874-55711896 AAAATGCAAAAAATTTAGCCAGG - Intergenic
931072489 2:58668648-58668670 AAAATACAAAAAATTTAGCCAGG - Intergenic
931153909 2:59606314-59606336 AAAGTGCAAAAAAATTAGCTGGG - Intergenic
931266970 2:60669243-60669265 AAAATGCAAAAAAATTAGCCAGG + Intergenic
931300207 2:60972307-60972329 AAAGTACAAAAAAATTAGCCGGG + Intronic
931311063 2:61081244-61081266 AATGTACAATAAATTTACCCTGG - Intronic
931339661 2:61387302-61387324 AAAGTACAAAAAATTTAGCCAGG + Intronic
931399172 2:61914849-61914871 CAAAAGCACAAAATTTAGCCAGG - Intronic
931399330 2:61916118-61916140 GAAATACAAAAAATTTAGCCAGG - Intronic
931706281 2:64948973-64948995 AAAGTACAAAAAAATTAGCCAGG + Intergenic
931727748 2:65127892-65127914 AAAATGCAAAAAAATTAGCCGGG - Intronic
931799595 2:65746060-65746082 GAACAGCAAAAAATTTAACCTGG - Intergenic
932106511 2:68948083-68948105 AAAATACAAAAAATTTAGCCGGG + Intronic
932107089 2:68953883-68953905 AAAGTACAAAAAAATTAGCCAGG + Intergenic
932318815 2:70805090-70805112 AAAATACAAAAAATTTAGCCGGG - Intergenic
932795943 2:74696354-74696376 AAAGTGCAAAAAAATTAGCTGGG - Intergenic
932965616 2:76471654-76471676 AAAATACAAAAAAATTACCCAGG + Intergenic
933104299 2:78303705-78303727 AAAATACAAAAAATTTAGCCAGG - Intergenic
933666053 2:84966019-84966041 AAAATGCAAAAAACTTAGCCAGG + Intergenic
933680531 2:85095845-85095867 AAAATGCAAAAAAATTAGCCAGG - Intergenic
933698838 2:85239782-85239804 AAAATACAAAAAATTTAGCCGGG + Intronic
933731687 2:85461085-85461107 AAAATCCAAAAAATTTAGCCAGG + Intergenic
934638639 2:96012592-96012614 AAAATGCAAAAAAATTAGCCAGG - Intergenic
934795011 2:97092810-97092832 AAAATGCAAAAAAATTAGCCAGG + Intronic
935357003 2:102210640-102210662 CAAGGTCAAAAAAGTTAACCAGG + Intronic
935664434 2:105497762-105497784 AAAATACAAAAAATTTAGCCAGG - Intergenic
935686485 2:105688302-105688324 AAAATGCAAAAAAATTAACCGGG - Intergenic
935749067 2:106214519-106214541 AAAATACAAAAAATTTAGCCGGG + Intergenic
936012240 2:108932366-108932388 AAAATACAAAAAAATTACCCGGG + Intronic
936623827 2:114127116-114127138 AAAATGCAAAAAATTTAGCTGGG - Intergenic
936708476 2:115103346-115103368 AAAGTACAAAAAAATTAGCCGGG - Intronic
937215183 2:120308213-120308235 AAAATGCAAAAAAATTAGCCAGG + Intergenic
937397463 2:121549843-121549865 AAAATGCAAAAAAATTAGCCAGG + Intronic
937669015 2:124518826-124518848 AAAATACAAAAAAATTACCCTGG + Intronic
937933294 2:127221871-127221893 AAAGTACAAAAAAATTAGCCTGG + Intergenic
938012104 2:127837120-127837142 AAAATGCAAAAAAATTAGCCAGG + Intergenic
938174373 2:129110877-129110899 AAAATGCAAAAAAATTAGCCGGG + Intergenic
938247059 2:129785902-129785924 CAAATACAAAAAAATTAGCCGGG - Intergenic
938414332 2:131091981-131092003 CAAATACAAAAAAATTAGCCAGG + Intronic
938596698 2:132794473-132794495 AAAATACAAAAAATTTAGCCAGG + Intronic
939240784 2:139557157-139557179 AAAATACAAAAAAATTACCCGGG - Intergenic
939432860 2:142132625-142132647 AAAGTACAAAAAAATTAGCCGGG - Intergenic
939438110 2:142204863-142204885 AAAATACAAAAAATTTAGCCAGG + Intergenic
939540910 2:143492599-143492621 AAAGTGAAAAAAAGTTAGCCAGG + Intronic
940192709 2:151059352-151059374 AAAGTACAAAAAAATTAGCCAGG - Intergenic
940231720 2:151461550-151461572 AAAGTACAAAAAAATTAGCCGGG - Intronic
940300745 2:152174652-152174674 CAAGTTCTAAAAATTTACCTAGG + Intronic
940579888 2:155565042-155565064 AAAGTACAAAAAAATTAGCCCGG - Intergenic
940892139 2:159045269-159045291 AAAATACAAAAAAATTACCCGGG + Intronic
940979103 2:159981564-159981586 AAAGTACAAAAAAATTAGCCAGG - Intronic
941028114 2:160480918-160480940 AAAATACAAAAAAATTACCCAGG + Intronic
941059704 2:160832390-160832412 AAAGTACAAAAAAATTAGCCAGG + Intergenic
941172647 2:162158354-162158376 AAAATACAAAAAATTTAGCCTGG - Intergenic
941340922 2:164302056-164302078 AAAATGCAAAAAATTTAGCTGGG + Intergenic
941503960 2:166316532-166316554 AAAGTACAAAAAAATTAGCCAGG + Intronic
941555537 2:166975763-166975785 AAAATGCAAAAAAATTAGCCGGG + Intronic
941597167 2:167491652-167491674 AAAATACAAAAAAATTACCCAGG + Intergenic
942016406 2:171821188-171821210 AAAATACAAAAAATTTAGCCAGG - Intronic
942560978 2:177218220-177218242 AAAATGCAAAAAAATTAACCGGG - Intronic
942647923 2:178134825-178134847 CTACTACAAAAAAATTACCCAGG + Intronic
942907392 2:181200274-181200296 AAAATGCAAAAAAATTAGCCAGG + Intergenic
942980715 2:182078018-182078040 AAAATGCAAAAAAATTAGCCGGG + Intronic
942993966 2:182238106-182238128 AAAATGCAAAAAAATTAGCCAGG + Intronic
943065457 2:183081403-183081425 AAAGTACAAAAAAATTAGCCAGG - Intronic
943537271 2:189168096-189168118 AAAATACAAAAAATTTAGCCAGG - Intronic
943617862 2:190114614-190114636 AAAGTACAAAAAAATTAGCCAGG - Intronic
943893503 2:193322179-193322201 AAAGTACAAAAAAATTAACCAGG - Intergenic
944006988 2:194921465-194921487 TAAGTTAACAAAATTTACCCAGG + Intergenic
944234689 2:197431276-197431298 AAAGTACAAAAAAATTAACCGGG - Intronic
944558765 2:200914324-200914346 AAAATACAAAAAATTTAGCCAGG - Intronic
944597491 2:201274633-201274655 AAAGTACAAAAAAATTAGCCGGG - Intronic
944625002 2:201561711-201561733 AAAGTACAAAAAAATTAGCCGGG + Intronic
944733544 2:202538631-202538653 AAAGTACAAAAAAATTAGCCGGG + Intronic
944795100 2:203176286-203176308 AAAATACAAAAAAATTACCCAGG - Intronic
944845315 2:203662316-203662338 AAAATACAAAAAAATTACCCCGG + Intergenic
944927023 2:204475928-204475950 CAAGTACCAAAAAGTTACACTGG + Intergenic
945396722 2:209327110-209327132 CAAATACAAAAAAATTAGCCAGG + Intergenic
945738767 2:213635193-213635215 CAAATACAAAAAAATTAGCCAGG - Intronic
945952018 2:216048233-216048255 AAAATACAAAAAAATTACCCGGG - Intronic
946308516 2:218870058-218870080 AAAGTACAAAAAAATTAGCCAGG + Intronic
946380109 2:219342022-219342044 AAAATGCAAAAAAATTAGCCGGG + Intergenic
946609819 2:221445427-221445449 AAAGTACAAAAAAATTAGCCGGG + Intronic
946628562 2:221641860-221641882 AAAGTACAAAAAAATTACCCGGG - Intergenic
946744035 2:222828262-222828284 AAAGTACAAAAAAATTAGCCGGG + Intergenic
946766544 2:223045999-223046021 AAAATGCAAAAAAATTAGCCAGG - Intergenic
946973862 2:225126179-225126201 AAAGTACAAAAAATTTAGCTGGG - Intergenic
947019337 2:225657268-225657290 AAAATACAAAAAATTTAGCCTGG - Intergenic
947248247 2:228074221-228074243 CAAGTACACAAAATTTACAATGG + Intronic
947391630 2:229645155-229645177 CAAATAAAAAAAATTTAACCGGG - Intronic
947675485 2:231975542-231975564 AAAATGCAAAAAAGTTAGCCAGG + Intronic
947686252 2:232088238-232088260 AAAATGCAAAAAAATTAGCCAGG + Intronic
948107003 2:235422211-235422233 AAAGTGCAAAAAAAGTAGCCGGG + Intergenic
948141221 2:235673102-235673124 CAAAGGCAAAGAATTTATCCAGG - Intronic
1168758971 20:335633-335655 AAAATGCAAAAAAATTACCTGGG - Intergenic
1169228210 20:3869331-3869353 AAAGTGCAAAAAAATTAGCCAGG - Exonic
1169253688 20:4081201-4081223 AAAATACAAAAAATTTAGCCGGG + Intergenic
1169832791 20:9842296-9842318 CAAATACAAAAAAATTAGCCGGG + Intergenic
1170016195 20:11785067-11785089 AAAGTGCAAAAAATTAACTTGGG + Intergenic
1170103132 20:12724242-12724264 CAAGTTAAAAAAAAATACCCAGG + Intergenic
1170169107 20:13391805-13391827 AAAATGCAAAAAAATTAGCCAGG + Intronic
1170193660 20:13668784-13668806 AAAATACAAAAAAATTACCCAGG - Intergenic
1170383565 20:15789744-15789766 CAAGTGCATAAAATTTAAAATGG + Intronic
1170991536 20:21305908-21305930 AAAGTACAAAAAAATTAGCCAGG - Intronic
1171131968 20:22662427-22662449 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1171225770 20:23440915-23440937 AAAATACAAAAAATTTAGCCAGG - Intronic
1171479788 20:25445505-25445527 AAAATGCAAAAAAATTAGCCAGG - Intronic
1172014926 20:31867803-31867825 AAAATGCAAAAAAATTAGCCGGG - Intronic
1172156265 20:32827245-32827267 AAAGTACAAAAAAATTAGCCGGG + Intronic
1172169346 20:32919655-32919677 AAAATACAAAAAATTTAGCCAGG - Intronic
1172333279 20:34091555-34091577 CAAATACAAAAAAATTAGCCAGG + Intronic
1172347804 20:34217720-34217742 AAAGTACAAAAAAATTAGCCGGG - Intronic
1172494753 20:35372149-35372171 AAAGTACAAAAAAATTAGCCGGG + Intronic
1172671551 20:36637785-36637807 AAAGTACAAAAAAATTAGCCAGG - Intronic
1172724319 20:37025901-37025923 AAAATACAAAAAAATTACCCAGG - Intronic
1172817089 20:37695887-37695909 AAAGTACAAGAAATTGACCCTGG + Intronic
1173194374 20:40902113-40902135 AAAATACAAAAAATTTAGCCAGG - Intergenic
1173342652 20:42166758-42166780 AAAGTACAAAAAAATTAGCCAGG + Intronic
1173778054 20:45728202-45728224 CATGTGCAGAAAATTGACACTGG + Intergenic
1173796574 20:45865008-45865030 AAAATACAAAAAATTTATCCAGG + Intronic
1173818717 20:46007302-46007324 AAAATACAAAAAATTTAGCCAGG + Intergenic
1173986386 20:47264874-47264896 AAAATACAAAAAATTTAGCCGGG + Intronic
1173996524 20:47342685-47342707 CAAATACAAAAAAATTAGCCGGG + Intronic
1174319748 20:49731992-49732014 AAAATGCAAAAAAATTACCCGGG + Intergenic
1174384178 20:50176928-50176950 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1174632780 20:51972699-51972721 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1174637031 20:52009978-52010000 AAAATACAAAAAATTTAGCCAGG + Intergenic
1174827340 20:53780435-53780457 CAAATACAAAAAAATTAGCCGGG - Intergenic
1174831282 20:53814517-53814539 AAAATACAAAAAAATTACCCGGG + Intergenic
1175347559 20:58291992-58292014 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1175865043 20:62171060-62171082 AAAATACAAAAAATTTAGCCCGG - Intronic
1175897073 20:62342516-62342538 AAAGTACAAAAAAATTAGCCGGG + Intronic
1176701958 21:10064338-10064360 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1177329767 21:19642880-19642902 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1177350832 21:19939134-19939156 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1177476495 21:21630788-21630810 CAATTGCAACAAATATACCCCGG + Intergenic
1177641438 21:23848871-23848893 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1177760769 21:25400037-25400059 CAAGTGGAAAAAGTTTTTCCTGG - Intergenic
1177888345 21:26774055-26774077 CAAATACAAAAAAATTAGCCAGG - Intergenic
1178200534 21:30398229-30398251 AAAGTACAAAAAAATTAGCCAGG - Intronic
1178295641 21:31407794-31407816 AAAATACAAAAAAATTACCCAGG - Intronic
1178296332 21:31413428-31413450 CAAATACAAAAAAATTAGCCGGG - Intronic
1178303196 21:31469669-31469691 AAAGTACAAAAAAATTAGCCGGG + Intronic
1178328253 21:31662852-31662874 AAAATGCAAAAAAATTAGCCGGG + Intronic
1178845002 21:36167331-36167353 CAAATACAAAAAAATTAGCCAGG - Intronic
1178852559 21:36225388-36225410 AAAGTACAAAAAAATTAGCCAGG - Intronic
1178869878 21:36364521-36364543 CAAATACAAAAAAATTAACCAGG + Intronic
1179267868 21:39820974-39820996 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1179556966 21:42185245-42185267 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1180628757 22:17212430-17212452 CAAATACAAAAAAATTAGCCGGG - Intronic
1181284920 22:21745010-21745032 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1181343815 22:22202863-22202885 AAAATACAAAAAATTTAGCCAGG - Intergenic
1181396129 22:22623775-22623797 CAAATACAAAAAAATTATCCAGG - Intergenic
1181751773 22:24993918-24993940 CAAATACAAAAAAATTAGCCGGG + Intronic
1181850545 22:25746959-25746981 AAAATGCAAAAAAATTAGCCAGG + Intronic
1182126503 22:27819726-27819748 TAAATACAAAAAAATTACCCAGG + Intergenic
1182232991 22:28852990-28853012 TAAATGAAAAAAATTTAGCCGGG + Intergenic
1182553027 22:31111668-31111690 AAAATACAAAAAAATTACCCAGG + Intronic
1182745833 22:32604843-32604865 AAAATGCAAAAAAATTAGCCGGG + Intronic
1182797600 22:33002481-33002503 AAAATACAAAAAAATTACCCGGG + Intronic
1182799007 22:33015058-33015080 AAAGTACAAAAAAATTAGCCGGG + Intronic
1182926931 22:34133939-34133961 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1182939840 22:34265042-34265064 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1183150413 22:36032565-36032587 AAAATACAAAAAATTTAGCCAGG + Intergenic
1183193814 22:36339315-36339337 CTAGTGCAAAAAGTGTACTCCGG - Intronic
1183249950 22:36723363-36723385 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1183431778 22:37770275-37770297 AAAATACAAAAAAATTACCCGGG + Intronic
1183765226 22:39867061-39867083 AAAATGCAAAAAAATTAGCCGGG - Intronic
1183830050 22:40413600-40413622 AAAATACAAAAAATTTATCCGGG - Intronic
1183848881 22:40566378-40566400 AAAATGCAAAAAAATTAGCCAGG - Intronic
1184584600 22:45439249-45439271 CAAATACAAAAAAATTAGCCGGG + Intergenic
1184701532 22:46177048-46177070 CAAATACAAAAAAATTAGCCGGG + Intronic
1184705021 22:46205375-46205397 TAAATACAAAAAACTTACCCGGG - Intronic
1184761344 22:46546532-46546554 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1184898843 22:47431108-47431130 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1184953035 22:47859594-47859616 CAAGGGAAAAAATTTTATCCAGG + Intergenic
1185323461 22:50213806-50213828 AAAATACAAAAAAATTACCCGGG - Intronic
1185379188 22:50499525-50499547 AAAGTACAAAAAAATTAGCCGGG - Intergenic
949327792 3:2886670-2886692 AAAATACAAAAAAATTACCCGGG - Intronic
949803646 3:7931103-7931125 CAACTTCAAAAAATCTACCTGGG + Intergenic
949906001 3:8858999-8859021 AAAGTGCAAAAAAATTAGCTGGG - Intronic
949910558 3:8902863-8902885 AAAGTACAAAAAAATTAGCCAGG + Intronic
949964713 3:9345623-9345645 AAAATGCAAAAAAATTAGCCGGG + Intronic
949983689 3:9521559-9521581 AAAGTACAAAAAAATTAGCCGGG - Intronic
950280549 3:11704220-11704242 CAAATACAAAAAAATTAGCCGGG + Intronic
950675495 3:14551752-14551774 CAAGTCCAAACATTTCACCCCGG - Intergenic
950989302 3:17415316-17415338 AAAGTACAAAAAATTTCGCCGGG - Intronic
951140569 3:19153790-19153812 AAAATGCAAAAAAATTAGCCAGG - Intronic
951228287 3:20146349-20146371 CAAATTCGAAAAGTTTACCCTGG + Exonic
951276887 3:20698538-20698560 AAAGTACAAAAAAATTAGCCAGG + Intergenic
951307556 3:21084150-21084172 AAAATACAAAAAATTTAGCCAGG + Intergenic
951347739 3:21566467-21566489 AAAGTACAAAAAAATTAGCCAGG + Intronic
951955094 3:28244566-28244588 AAAATACAAAAAATTTAGCCAGG + Intronic
952034017 3:29178010-29178032 AAAATGCAAAAAAATTAGCCAGG - Intergenic
952230715 3:31427183-31427205 AAAGTACAAAAAAATTAGCCAGG - Intergenic
952339697 3:32435241-32435263 CAAATACAAAAAAATTAGCCGGG + Intronic
952553618 3:34507098-34507120 AAAATACAAAAAATTTAGCCAGG + Intergenic
952696016 3:36265882-36265904 AAAATACAAAAAATTTAGCCAGG - Intergenic
952764103 3:36940337-36940359 AAAGTACAAAAAAATTAGCCGGG + Intronic
953373039 3:42406291-42406313 AAAATACAAAAAATTTAGCCAGG + Intronic
953625150 3:44564959-44564981 AAAGTACAAAAAAATTAGCCAGG - Intronic
953710983 3:45270697-45270719 CAAATACAAAAAAATTAGCCAGG + Intergenic
954052319 3:47990450-47990472 AAAATGCAAAAAACTTAGCCAGG + Intronic
954171510 3:48806929-48806951 AAAGTACAAAAAAATTAGCCAGG - Intronic
954194372 3:48987710-48987732 CAAATACAAAAAAATTAGCCGGG + Intergenic
954251077 3:49368068-49368090 AAAGTACAAAAAAATTAGCCAGG - Intronic
954298728 3:49688060-49688082 CTTGTGAAAAAAATTTCCCCTGG + Intronic
954309919 3:49758147-49758169 AAAGTACAAAAAAATTAGCCAGG + Intronic
954560031 3:51548982-51549004 CAAATACAAAAAAATTAGCCGGG - Intronic
954606367 3:51913697-51913719 TAAATACAAAAAATTTAGCCAGG + Intergenic
954735096 3:52700902-52700924 AAACTGCAAAAAAATTAGCCAGG + Intronic
954741532 3:52754911-52754933 AAAATGCAAAAAAATTAGCCGGG + Intronic
955093208 3:55772473-55772495 AAAATACAAAAAATTTAGCCAGG - Intronic
955277386 3:57559058-57559080 CAAATACAAAAAAATTAGCCGGG + Intronic
955296840 3:57743399-57743421 CAAATACAAAAAAATTAGCCAGG + Intergenic
955327120 3:58017409-58017431 AAAATGCAAAAAAATTATCCAGG - Intronic
955579899 3:60407673-60407695 AAAATACAAAAAATTTAGCCAGG - Intronic
956024129 3:64964222-64964244 AAAGTACAAAAAAATTAGCCGGG - Intergenic
956120008 3:65956839-65956861 AAAATGCAAAAAAATTAGCCTGG + Intronic
956970754 3:74522496-74522518 CAAGTGCAAGTAATTTACTTGGG + Intergenic
957002968 3:74908313-74908335 AAAGTACAAAAAATTTAGCCAGG - Intergenic
957185855 3:76940140-76940162 AAAATACAAAAAAATTACCCGGG - Intronic
957246352 3:77721679-77721701 AAAATGCAAAAAAATTAGCCAGG - Intergenic
957663625 3:83194296-83194318 AAAATACAAAAAATTTAGCCGGG + Intergenic
957844803 3:85717926-85717948 AAAATACAAAAAATTTAGCCAGG - Intronic
958139351 3:89541141-89541163 AAAATGCAAAAAAATTAGCCGGG - Intergenic
958620509 3:96552311-96552333 AAAATACAAAAAAATTACCCAGG - Intergenic
958647622 3:96892379-96892401 AAAGTACAAAAAAATTAACCAGG - Intronic
958801976 3:98766579-98766601 AAAATGCAAAAAAATTAGCCGGG - Intronic
958947796 3:100383360-100383382 AAAGTACAAAAAAATTAGCCAGG + Intronic
959111681 3:102130311-102130333 CAACTGCTAAAAATTTCCTCAGG - Intronic
959597552 3:108144403-108144425 GAAATACAAAAAATTTAGCCCGG + Intergenic
959676480 3:109041550-109041572 AAAATGCAAAAAAATTAGCCCGG + Intronic
960028670 3:113036092-113036114 AAAATGCAAAAAAATTAGCCAGG + Intergenic
960066938 3:113384217-113384239 AAAATACAAAAAAATTACCCAGG - Intronic
960095110 3:113681877-113681899 AAAATGCAAAAAAATTAGCCAGG - Intronic
960152490 3:114264391-114264413 AAAGTACAAAAAAATTAGCCAGG - Intergenic
960164858 3:114389726-114389748 AAAATGCAAAAAAATTAGCCAGG + Intronic
960370753 3:116835379-116835401 CATTTTCAAAAAATTTGCCCTGG - Intronic
960467436 3:118014504-118014526 AAAATACAAAAAAATTACCCAGG - Intergenic
961588939 3:127960373-127960395 CAAATGCAAAATATATACCCTGG - Intronic
961610429 3:128132965-128132987 CAAGTCCAAAAATGTCACCCAGG - Intronic
961687147 3:128641767-128641789 AAAATGCAAAAAAGTTAGCCAGG - Intronic
961759605 3:129156236-129156258 AAAGTACAAAAAAATTAGCCGGG + Intronic
961848824 3:129794463-129794485 GAAGTGCAAAGAATTTCCCTGGG + Intronic
962313249 3:134340747-134340769 CAAGTGAAAAAAATGCAGCCAGG + Intergenic
962560083 3:136596912-136596934 AAAATACAAAAAATTTAGCCAGG + Intronic
962719436 3:138159030-138159052 AAAGTACAAAAAAATTAGCCGGG + Intergenic
962784986 3:138760080-138760102 AAAATACAAAAAATTTAGCCAGG - Intronic
963204653 3:142620283-142620305 CAAATACAAAAAAATTAGCCAGG - Intronic
963533829 3:146503354-146503376 CAAATGGAAAATATATACCCTGG - Intergenic
963883430 3:150553567-150553589 CAAATACAAAAAAATTAGCCAGG - Intronic
964109518 3:153074146-153074168 AAAATACAAAAAAATTACCCGGG + Intergenic
964365120 3:155942245-155942267 AAAGTACAAAAAAATTAGCCGGG - Exonic
964798278 3:160523688-160523710 AAAATGCAAAAAAATTAGCCAGG + Intronic
965053032 3:163675917-163675939 CAAGTGGAAAAAACTTCCCATGG + Intergenic
965087673 3:164120362-164120384 AAAATACAAAAAATTTAGCCGGG + Intergenic
965143180 3:164865185-164865207 AAAGTACAAAAAAATTAGCCGGG + Intergenic
965416551 3:168401896-168401918 AAAATACAAAAAATTTAGCCAGG - Intergenic
965470124 3:169080294-169080316 AAAATGCAAAAAAATTAGCCGGG - Intergenic
965593233 3:170381919-170381941 AAAATGCAAAAAAATTAGCCGGG + Intronic
965648970 3:170913541-170913563 AAAGTACAAAAAAATTAGCCAGG - Intergenic
965705322 3:171500667-171500689 AAAATGCAAAAAAATTAGCCGGG - Intergenic
965853304 3:173057270-173057292 AAAATACAAAAAAATTACCCAGG - Intronic
966170022 3:177069576-177069598 AAAATACAAAAAAATTACCCAGG + Intronic
966260644 3:177974733-177974755 AAAGTACAAAAAATTTAGCCAGG - Intergenic
966386668 3:179406771-179406793 AAAATGCAAAAAAATTAGCCAGG - Intronic
966425694 3:179777611-179777633 CAAATACAAAAAAATTAGCCAGG - Intronic
966425808 3:179778603-179778625 AAAATGCAAAAAAATTAGCCGGG + Intronic
966636291 3:182137609-182137631 AAAATACAAAAAATTTAGCCGGG + Intergenic
966724565 3:183098086-183098108 AAAATACAAAAAATTTAGCCGGG - Intronic
966778267 3:183561809-183561831 AAAATACAAAAAAATTACCCAGG + Intergenic
966795072 3:183705877-183705899 AAAATGCAAAAAAATTAGCCAGG + Intronic
966796472 3:183719294-183719316 AAAGTACAAAAAAATTAGCCAGG - Intronic
966834963 3:184042302-184042324 AAAGTACAAAAAAATTAGCCAGG - Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
967585129 3:191204046-191204068 CAAATACAAAAAAATTAGCCAGG - Intronic
967687995 3:192439814-192439836 AAAATACAAAAAATTTAGCCGGG + Intronic
967693415 3:192503764-192503786 AAAATACAAAAAATTTAGCCGGG - Intronic
967753434 3:193141199-193141221 AAAATGCAAAAAAATTAGCCGGG + Intergenic
967802358 3:193676818-193676840 AAAATACAAAAAATTTAGCCAGG + Intronic
967838667 3:193985880-193985902 AAAATGCAAAAAAATTAGCCGGG - Intergenic
967870106 3:194222766-194222788 AAAATGCAAAAAAATTAGCCGGG - Intergenic
967909662 3:194531492-194531514 AAAGTACAAAAAAATTAGCCAGG - Intergenic
968163857 3:196448582-196448604 AAAATACAAAAAATTTAGCCGGG - Intergenic
968182103 3:196603352-196603374 AAAGTACAAAAAAATTAGCCGGG + Intergenic
968193197 3:196685843-196685865 AAAGTACAAAAAATTTAGCCGGG + Intronic
968384312 4:122928-122950 AAAATACAAAAAAATTACCCAGG - Intergenic
968444428 4:642633-642655 AAAATGCAAAAAAGTTAGCCAGG + Intronic
968836802 4:2970828-2970850 AAAATGCAAAAAAATTAGCCAGG - Intronic
969354596 4:6618006-6618028 AAAGTACAAAAAAATTAGCCGGG - Intronic
969385367 4:6842744-6842766 AAAATGCAAAAAAATTAGCCAGG - Intronic
970144897 4:13025527-13025549 CAAGTTAAAAAAAATTACCCTGG + Intergenic
970295501 4:14625095-14625117 AAAATACAAAAAATTTAGCCGGG - Intergenic
970366177 4:15360351-15360373 CAATTGCCAAAAATATAACCAGG - Intronic
970462289 4:16286899-16286921 AAAATGCAAAAAAATTAGCCAGG + Intergenic
970465548 4:16319104-16319126 AAAATGCAAAAAAATTAGCCAGG - Intergenic
970497865 4:16645374-16645396 AAAATGCAAAAAAATTAGCCGGG + Intronic
970504566 4:16714414-16714436 CAAGTGCAAAAAAGTCCTCCAGG - Intronic
970621327 4:17822348-17822370 AAAGTACAAAAAAATTAGCCAGG - Intronic
970887989 4:21008682-21008704 AAAATGCAAAAAAATTAGCCGGG - Intronic
971104931 4:23514303-23514325 AAAATACAAAAAAATTACCCGGG - Intergenic
971134185 4:23848981-23849003 AAAATACAAAAAATTTAGCCGGG + Intronic
971261516 4:25061472-25061494 GAAAGGCAAAGAATTTACCCAGG + Intergenic
971408341 4:26343706-26343728 GAAGTACAAAAAAATTAGCCAGG - Intronic
971422337 4:26485031-26485053 AAAATGCAAAAAAATTAGCCGGG + Intronic
971596278 4:28533374-28533396 CAAATACAAAAAAATTAGCCGGG - Intergenic
972061826 4:34883807-34883829 AAAATGCAAAAAAATTAGCCAGG - Intergenic
972096609 4:35354859-35354881 AAAATGCAAAAAATTTAGCCGGG + Intergenic
972344538 4:38182120-38182142 AAAATGCAAAAAAATTAGCCAGG + Intergenic
972402867 4:38721344-38721366 AAAGTACAAAAAAATTAGCCAGG - Intergenic
972507267 4:39731519-39731541 CAAATACAAAAAAATTAGCCAGG + Intronic
972530542 4:39957623-39957645 AAAGTACAAAAAAATTAGCCGGG + Intronic
972608806 4:40638189-40638211 CAAATACAAAAAAATTAGCCAGG + Intergenic
973201239 4:47504721-47504743 AAAATGCAAAAAAATTAGCCAGG - Intronic
973909608 4:55566138-55566160 AAAGTACAAAAAAATTAGCCGGG - Intronic
973977043 4:56272732-56272754 AAAGTACAAAAAAATTAGCCAGG + Intronic
975131580 4:70837794-70837816 AAAATGCAAAAAAATTAGCCGGG - Intronic
975145114 4:70958323-70958345 AAAATGCAAAAAAATTAGCCAGG - Intronic
975159318 4:71107505-71107527 AAAATGCAAAAAAATTAGCCGGG - Intergenic
975551384 4:75616502-75616524 AAAATACAAAAAAATTACCCAGG + Intronic
975585539 4:75944622-75944644 AAAATGCAAAAAAATTAGCCAGG - Intronic
975799413 4:78044114-78044136 AAAGTACAAAAAAATTAGCCAGG - Intergenic
975951874 4:79783489-79783511 AAAATACAAAAAATTTAGCCGGG + Intergenic
975953432 4:79804219-79804241 AAAGTACAAAAAAATTAGCCAGG - Intergenic
976169661 4:82290054-82290076 AAAATGCAAAAAAATTAGCCGGG + Intergenic
976197855 4:82550626-82550648 AAAGTACAAAAAAATTAGCCAGG + Intronic
976294928 4:83460743-83460765 CAAATACAAAAAAATTATCCGGG + Exonic
976725443 4:88211575-88211597 AAAATACAAAAAAATTACCCAGG - Intronic
976834316 4:89353286-89353308 AAAGTACAAAAAAATTAGCCGGG + Intergenic
976901832 4:90187063-90187085 AAAATGCAAACATTTTACCCAGG - Intronic
976968089 4:91070143-91070165 AAAATACAAAAAATTTAGCCAGG - Intronic
977378858 4:96243909-96243931 CAAATGCATAAAAATCACCCAGG + Intergenic
977419359 4:96778453-96778475 AAAATACAAAAAAATTACCCAGG + Intergenic
977866329 4:102032722-102032744 AAAATACAAAAAAGTTACCCAGG + Intronic
978454334 4:108871474-108871496 AAAATGCAAAAAAATTAGCCGGG - Intronic
978741035 4:112138227-112138249 AAAATGCAAAAAAATTAGCCGGG - Intergenic
978853866 4:113370597-113370619 CAAATACAAAAAAATTAGCCAGG + Intronic
979243337 4:118469669-118469691 AAAATCCAAAAAAATTACCCGGG + Intergenic
979430198 4:120620516-120620538 AAAGTACAAAAAAATTAGCCAGG + Intergenic
979484761 4:121257732-121257754 AAAATGCAAAAAAATTAGCCAGG + Intergenic
979683949 4:123490352-123490374 AAAATGCAAAAAAATTAGCCAGG - Intergenic
980050709 4:128036956-128036978 AAAGTACAAAAAAATTAGCCGGG + Intronic
980058771 4:128105729-128105751 AAAGTACAAAAAAATTAGCCGGG + Intronic
980260847 4:130445308-130445330 AAAATGCAAAAAAATTAGCCAGG - Intergenic
980372691 4:131898272-131898294 AAAGTACAAAAAAATTAGCCTGG + Intergenic
980639828 4:135563197-135563219 CAAATACAAAAAATTTAGCCAGG + Intergenic
981143092 4:141293088-141293110 AAAATACAAAAAATTTAGCCGGG + Intergenic
981309204 4:143279875-143279897 AAAATACAAAAAATTTAGCCAGG - Intergenic
981729055 4:147878254-147878276 AAAATACAAAAAATTTAGCCAGG - Intronic
981768405 4:148278467-148278489 GATGTGCAAAAAACTTTCCCAGG + Intronic
982167922 4:152631963-152631985 AAAGTACAAAAAAATTAGCCGGG - Intronic
982898763 4:160970976-160970998 AAAATGCAAAAAAATTAGCCAGG + Intergenic
983131153 4:164021694-164021716 AAAATACAAAAAATTTAGCCGGG + Intronic
983223561 4:165065656-165065678 AAAGTACAAAAAAATTAGCCGGG + Intergenic
983265697 4:165505593-165505615 AAAGTACAAAAAAATTAGCCGGG - Intergenic
983422861 4:167542501-167542523 AAAGTACAAAAAAATTAGCCGGG + Intergenic
983457236 4:167980452-167980474 CAAATACAAAAAAATTAGCCAGG + Intergenic
983522036 4:168719416-168719438 AAAGTACAAAAAAATTAGCCAGG - Intronic
983709691 4:170698585-170698607 CAAGTGCAAAAAGGTTAGCTTGG + Intergenic
983830011 4:172314766-172314788 AAAATACAAAAAATTTAGCCAGG - Intronic
984068816 4:175085788-175085810 AAAGTACAAAAAAATTAGCCAGG + Intergenic
984223136 4:177002878-177002900 AAAGTACAAAAAATTTAGCTGGG - Intergenic
984236771 4:177168815-177168837 AAAATGCAAAAAAATTAGCCAGG - Intergenic
984266997 4:177507423-177507445 AAAATACAAAAAAATTACCCAGG - Intergenic
984623812 4:181982634-181982656 AAAGTGCCTAACATTTACCCAGG + Intergenic
984807752 4:183767001-183767023 CAAATACAAAAAAATTAGCCGGG + Intergenic
985112903 4:186564262-186564284 AAAATGCAAAAAATTTAGCCGGG - Intergenic
985124488 4:186679254-186679276 AAAATACAAAAAAATTACCCGGG + Intronic
985227216 4:187774886-187774908 AAAGTACAAAAAAATTAGCCAGG - Intergenic
985233032 4:187842246-187842268 AAAATGCAAAAAATTTAGCCAGG + Intergenic
985282585 4:188301685-188301707 AAAATGCAAAAAAATTAGCCGGG - Intergenic
986187549 5:5459031-5459053 AAAATGCAAAAAAATTAGCCAGG - Intronic
986253566 5:6082922-6082944 CAAGTGCAAAGAATTCACCCAGG + Intergenic
986791570 5:11166407-11166429 AAAATACAAAAAATTTAGCCGGG - Intronic
986864987 5:11976050-11976072 CAAGAATAAAAAGTTTACCCAGG - Intergenic
986875006 5:12096790-12096812 AAAATACAAAAAATTTAGCCGGG + Intergenic
987326296 5:16814300-16814322 AAAGTACAAAAAAATTAGCCGGG - Intronic
987706125 5:21463601-21463623 AAAATACAAAAAATTTAGCCAGG - Intergenic
987980088 5:25073076-25073098 AAAATGCAAAAAAATTAGCCGGG + Intergenic
988334041 5:29882072-29882094 CAGGTGCAAACAATTTATTCAGG - Intergenic
988342949 5:29998775-29998797 AAAGTACAAAAAAATTAGCCTGG - Intergenic
988477313 5:31598141-31598163 AAAATACAAAAAATTTAGCCGGG + Intergenic
988492262 5:31714896-31714918 AAAGTACAAAAAAATTAGCCAGG + Intronic
988532246 5:32038000-32038022 AAAATGCAAAAAAATTAGCCAGG - Intronic
988572009 5:32376994-32377016 AAAATACAAAAAATTTAGCCGGG + Intronic
988632643 5:32947295-32947317 AAAATACAAAAAATTTAGCCGGG + Intergenic
988807194 5:34751298-34751320 AAAGTACAAAAAAATTAGCCAGG - Intronic
988839749 5:35072054-35072076 AAAGTACAAAAAAATTAGCCAGG - Intronic
988887786 5:35577647-35577669 AAAGTACAAAAAAATTAGCCGGG - Intergenic
989182864 5:38595892-38595914 AAAATGCAAAAAAATTAGCCGGG - Intronic
989578753 5:43012556-43012578 AAAATGCAAAAAAATTAGCCGGG - Intergenic
989760602 5:45011627-45011649 AAAATACAAAAAAATTACCCGGG + Intergenic
990324823 5:54664641-54664663 CAACAGCAAAAAATAAACCCTGG + Intergenic
990479785 5:56198917-56198939 AAAATACAAAAAATTTAGCCGGG + Intronic
990985713 5:61639165-61639187 CAAATACAAAAAAATTAGCCGGG - Intronic
991176885 5:63698917-63698939 AAAGTACAAAAAAATTAGCCAGG + Intergenic
991307605 5:65196360-65196382 AAAATACAAAAAATTTAGCCGGG + Intronic
991396617 5:66210693-66210715 TAAGTACAAAAAAATTAGCCAGG - Intergenic
991702457 5:69329322-69329344 CAAGAACAAAAAAATTAGCCAGG - Intronic
991718813 5:69476814-69476836 AAAGTACAAAAAAATTAGCCGGG + Intergenic
993009707 5:82465989-82466011 AAAATACAAAAAAATTACCCGGG - Intergenic
993022905 5:82613168-82613190 CAAATACAAAAAAATTAGCCAGG + Intergenic
993125921 5:83835522-83835544 CAAAAACAAAAAATTTAGCCAGG + Intergenic
993184084 5:84593564-84593586 AAAATGCAAAAAAATTAGCCGGG + Intergenic
993529565 5:89007099-89007121 AAAATACAAAAAATTTAGCCCGG - Intergenic
993534309 5:89062594-89062616 AAAATGCAAAAAAATTAGCCAGG - Intergenic
993778672 5:92037332-92037354 AAAGTACAAAAAAATTAGCCGGG - Intergenic
993930817 5:93937031-93937053 AAAATACAAAAAATTAACCCGGG - Intronic
994343635 5:98661187-98661209 AAAGTACAAAAAAATTAGCCGGG - Intergenic
994471067 5:100208493-100208515 TAAGAGCGAATAATTTACCCAGG + Intergenic
994943120 5:106350367-106350389 AAAGTACAAAAAAATTAGCCGGG - Intergenic
995860253 5:116633633-116633655 CAAATACAAAAAAATTAGCCAGG - Intergenic
996094069 5:119379749-119379771 AAAATACAAAAAAATTACCCAGG - Intronic
996138055 5:119869467-119869489 AAAATACAAAAAAATTACCCTGG - Intergenic
996686136 5:126282990-126283012 AAAATACAAAAAATTTAGCCGGG + Intergenic
996710437 5:126537969-126537991 AAAGTACAAAAAAATTAGCCGGG + Intergenic
996740652 5:126795783-126795805 CAAATACAAAAAAATTAGCCAGG - Intronic
997126776 5:131235047-131235069 AAACTACAAAAAATTTAGCCAGG - Intergenic
997327021 5:133030067-133030089 AAAATACAAAAAATTTAGCCAGG - Intergenic
997484516 5:134218827-134218849 AAAATACAAAAAATTTAGCCAGG - Intronic
997935631 5:138108365-138108387 AAAATGCAAAAAAATTAGCCGGG - Intergenic
997950290 5:138237349-138237371 AAAGTACAAAAAAATTAGCCAGG - Intergenic
997989452 5:138531884-138531906 AAAATGCAAAAAAATTAGCCGGG + Intronic
998022454 5:138781393-138781415 AAAATGCAAAAAAATTAGCCGGG + Intronic
998118700 5:139559264-139559286 AAAATACAAAAAAATTACCCGGG + Intronic
998264586 5:140658476-140658498 AAAGTACAAAAAAATTAGCCGGG - Intronic
998324417 5:141266864-141266886 CAACAGCAAAACATTTACTCAGG + Intergenic
998383121 5:141740064-141740086 AAAATGCAAAAAAATTAGCCGGG + Intergenic
998433927 5:142090558-142090580 AAAGTACAAAAAAATTAGCCAGG + Intergenic
998502545 5:142646067-142646089 CAAATACAAAAAAATTAGCCGGG - Intronic
998826707 5:146108977-146108999 AAAATGCAAAAAACTTAGCCAGG + Intergenic
998885850 5:146692918-146692940 CAAGTATAAAAAATGTACACTGG - Intronic
999017298 5:148120982-148121004 AAAGTACAAAAAAATTAGCCGGG + Intronic
999336684 5:150724995-150725017 AAAGTACAAAAAAATTAGCCAGG + Intronic
999558443 5:152771848-152771870 AATGTGCAAAATAATTACCCAGG - Intergenic
999569649 5:152905160-152905182 CAAGCTAAAAAAATTGACCCTGG - Intergenic
999757074 5:154672432-154672454 AAAATACAAAAAATTTAGCCAGG - Intergenic
999838679 5:155401309-155401331 AAAATACAAAAAATTTAGCCAGG + Intergenic
999999529 5:157124464-157124486 GAAATACAAAAAATTTAGCCAGG + Intronic
1000049726 5:157551988-157552010 AAAATGCAAAAAAATTAACCAGG + Intronic
1000080107 5:157837239-157837261 AAAGTATAAAAAAATTACCCAGG + Intronic
1000278477 5:159761459-159761481 AAAATACAAAAAATTTAGCCAGG + Intergenic
1000419689 5:161024424-161024446 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1000769802 5:165338852-165338874 AAAATACAAAAAAATTACCCAGG - Intergenic
1000805349 5:165783860-165783882 AAAGTACAAAAAAATTAACCGGG + Intergenic
1000845512 5:166274992-166275014 CAAGTACAAAAAAATTAGCCGGG - Intergenic
1000878840 5:166672712-166672734 CTAGAGAAAAAAATTTACCTTGG - Intergenic
1001154060 5:169257711-169257733 AAAATGCAAAAAAATTAGCCAGG - Intronic
1001334782 5:170788186-170788208 AAAATACAAAAAAATTACCCAGG + Intronic
1001782537 5:174382556-174382578 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1001909958 5:175507810-175507832 AAAATGCAAAAAAATTAACCAGG + Intronic
1001994200 5:176142487-176142509 CAAGTTGCAAAAATTTGCCCAGG + Intergenic
1002378262 5:178804509-178804531 TAAGTACAAAAAAATTAGCCAGG + Intergenic
1002507125 5:179687261-179687283 CAAATACAAAAAAATTAGCCGGG - Intronic
1003057675 6:2837437-2837459 AAAATACAAAAAATTTAGCCAGG - Intronic
1003401358 6:5793782-5793804 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1003688279 6:8326497-8326519 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1004082871 6:12412914-12412936 AAAATACAAAAAATTTAGCCAGG - Intergenic
1004085832 6:12448230-12448252 CAAGTACAAAAAAATTAGCCTGG - Intergenic
1004232341 6:13844881-13844903 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1004257892 6:14081660-14081682 CAACAACAAAAAATTTAGCCCGG + Intergenic
1004267652 6:14163159-14163181 CAAGTTTAAAACATTCACCCAGG + Intergenic
1004359223 6:14956256-14956278 AAAGTACAAAAAAATTACCGGGG - Intergenic
1004397085 6:15254879-15254901 AAAATGCAAAAAAGTTAGCCAGG + Intronic
1004491088 6:16117071-16117093 AAAATACAAAAAATTTAGCCAGG - Intergenic
1004575899 6:16894334-16894356 CAACTGCATAAAATTTACTGTGG + Intergenic
1004622620 6:17344303-17344325 AAAATACAAAAAATTTAGCCAGG + Intergenic
1004853439 6:19724772-19724794 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1004861743 6:19811051-19811073 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1004863298 6:19828781-19828803 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1004941093 6:20556875-20556897 AAAGTACAAAAAAATTAGCCGGG + Intronic
1004941926 6:20568034-20568056 AAAGTACAAAAAAATTAGCCGGG - Intronic
1005271525 6:24169755-24169777 CAAATACAAAAAAATTAGCCAGG - Intergenic
1005304477 6:24499817-24499839 AAAATACAAAAAAATTACCCGGG - Intronic
1005334542 6:24781040-24781062 AAAGTACAAAAAAATTAGCCGGG + Intronic
1005472220 6:26172323-26172345 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1005526551 6:26657087-26657109 AAAGTACAAAAAAATTAGCCAGG + Intronic
1005580399 6:27228623-27228645 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1005642755 6:27812547-27812569 AAAATACAAAAAATTTAGCCAGG + Intergenic
1005710636 6:28500955-28500977 TAAATACAAAAAATTTAGCCGGG - Intergenic
1005722594 6:28617439-28617461 CAAATACAAAAAAATTAGCCGGG - Intergenic
1006307221 6:33230513-33230535 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1006530669 6:34650589-34650611 AAACTGCAAAAAAATTAGCCAGG - Intronic
1006536185 6:34700860-34700882 AAAATACAAAAAATTTAGCCAGG - Intergenic
1006753592 6:36395840-36395862 AAAATACAAAAAAATTACCCAGG + Intronic
1007774325 6:44216489-44216511 CAAATACAAAAAAATTAGCCTGG + Intergenic
1007879979 6:45153907-45153929 AAAATGCAAAAAAATTAGCCAGG + Intronic
1008049139 6:46882314-46882336 AATGTGCAAAAAATTTACTCAGG + Intronic
1008251941 6:49251000-49251022 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1008399453 6:51047970-51047992 GAAATACAAAAAATTTAGCCGGG + Intergenic
1009022163 6:57957278-57957300 AAAATACAAAAAATTTAGCCAGG + Intergenic
1009024448 6:57981964-57981986 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1009351110 6:62680105-62680127 GAAGTACAAAAAAATTAGCCGGG + Intergenic
1009400848 6:63253849-63253871 CAAATACAAAAAATTAGCCCGGG + Intergenic
1009408507 6:63337641-63337663 AAAATACAAAAAATTTAGCCAGG + Intergenic
1009771693 6:68152231-68152253 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1009861127 6:69333767-69333789 AAAATGCAAAAAAATTAGCCGGG + Intronic
1009919789 6:70043350-70043372 AAAGTACAAAAAAATTAGCCAGG - Intronic
1010164292 6:72897379-72897401 AAAGTACAAAAAAATTAGCCGGG + Intronic
1010256266 6:73761679-73761701 AAAATGCAAAAAAATTAGCCAGG - Intronic
1010392975 6:75358072-75358094 CAAATGCCAAAAATTTACTAAGG + Intronic
1010627964 6:78161753-78161775 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1010911795 6:81567447-81567469 CAAAAGTAAAAAAATTACCCAGG - Intronic
1011247498 6:85334991-85335013 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1011270884 6:85578975-85578997 AAAGTACAAAAAAATTAGCCGGG + Intronic
1011300784 6:85871126-85871148 AAATTACAAAAAATTTCCCCGGG - Intergenic
1011425992 6:87230571-87230593 AAAGTACAAAAAAATTAGCCGGG + Intronic
1011799761 6:90999046-90999068 CAAGTACAAAACAATTAGCCAGG - Intergenic
1012069133 6:94589808-94589830 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1012186410 6:96222769-96222791 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1012259063 6:97066905-97066927 CCAGTGCTTAAAATGTACCCAGG + Intronic
1012518465 6:100091899-100091921 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1012621203 6:101346302-101346324 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1012809126 6:103935797-103935819 CAAATACAAAAAAATTAGCCGGG - Intergenic
1012873187 6:104695887-104695909 AAAATACAAAAAAATTACCCGGG - Intergenic
1013037102 6:106396177-106396199 CAAAGGAAAAAAAATTACCCTGG - Intergenic
1013090601 6:106897056-106897078 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1013133999 6:107262067-107262089 AAAATGCAAAAAAATTAGCCGGG - Intronic
1013198004 6:107862941-107862963 CAAATGCAAAAAATTCAGGCAGG + Intergenic
1013241931 6:108254301-108254323 CAAATACAAAAAAATTAGCCAGG + Intronic
1013795673 6:113885907-113885929 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1014072629 6:117201141-117201163 CTAATAAAAAAAATTTACCCCGG + Intergenic
1014331559 6:120072891-120072913 GAAGTGAAAAAAATTTCCACAGG - Intergenic
1014340737 6:120203769-120203791 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1015146991 6:129998080-129998102 AAAATACAAAAAAATTACCCGGG - Intergenic
1015329622 6:131962174-131962196 AAAGTACAAAAAACTTAGCCAGG - Intergenic
1015381916 6:132579474-132579496 AAAATGCAAAAAAATTAGCCTGG + Intergenic
1015408256 6:132861976-132861998 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1015532743 6:134237213-134237235 AAAATGCAAAAAAATTAGCCGGG - Intronic
1015851962 6:137583536-137583558 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1016262585 6:142189915-142189937 AAAGTACAAAAAAATTAGCCAGG - Intronic
1016287875 6:142493461-142493483 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1016724493 6:147346577-147346599 AAAGTACAAAAAAATTAGCCAGG + Intronic
1016792778 6:148083354-148083376 CATGTACAAACAATATACCCTGG - Intergenic
1016922557 6:149310173-149310195 CAAATACAAAAAAATTAGCCAGG + Intronic
1017151631 6:151286034-151286056 AAAATACAAAAAAATTACCCAGG - Intronic
1017192904 6:151672317-151672339 CAAATACAAAAAAATTAGCCTGG - Intronic
1017258675 6:152363039-152363061 AAAGTACAAAAAAATTAGCCGGG - Intronic
1017468435 6:154716687-154716709 AAAATACAAAAAATTTAGCCAGG + Intergenic
1017598681 6:156058242-156058264 CAAGTGCAAATAATTCACTTGGG - Intergenic
1017911760 6:158799210-158799232 CATGTGAAAAAAAATCACCCAGG + Intronic
1017987072 6:159453342-159453364 CATATGCAGAAAATTGACCCTGG + Intergenic
1018360104 6:163058737-163058759 AAAATACAAAAAATTTAGCCAGG + Intronic
1018535847 6:164818332-164818354 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1019182458 6:170199240-170199262 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1019271599 7:152206-152228 AAAATACAAAAAATTTAGCCAGG - Intergenic
1019499876 7:1359552-1359574 AAAATACAAAAAAATTACCCGGG - Intergenic
1019729098 7:2620560-2620582 AAAATACAAAAAATTTAGCCGGG - Intergenic
1019783873 7:2961010-2961032 AAAGTGCAAAAAAATTAGCCGGG + Intronic
1019797042 7:3057972-3057994 AAAATGCAAAAAATTTAGCCAGG + Intergenic
1019815796 7:3199382-3199404 AAAATACAAAAAATTTAGCCGGG - Intergenic
1019869367 7:3744649-3744671 CAAATACAAAAAAATTAGCCAGG + Intronic
1019998605 7:4741487-4741509 AAAATACAAAAAATTTAGCCAGG - Intronic
1020180354 7:5917716-5917738 AAAGTACAAAAAAATTAGCCGGG - Intronic
1020201959 7:6086884-6086906 AAAATACAAAAAATTTAGCCAGG - Intergenic
1020252259 7:6478947-6478969 AAATTACAAAAAAGTTACCCGGG - Intronic
1020302577 7:6807166-6807188 AAAGTACAAAAAAATTAGCCGGG + Intronic
1020839906 7:13203333-13203355 CAAATACAAAAAAATTAGCCGGG - Intergenic
1020867845 7:13589915-13589937 AAAATACAAAAAAATTACCCAGG - Intergenic
1021084804 7:16409391-16409413 CAAGAGCATAAATTTTACTCTGG + Intronic
1021090661 7:16478892-16478914 AAAATGCAAAAAAATTAGCCAGG - Intronic
1021349122 7:19567872-19567894 AAAATACAAAAAATTTATCCGGG - Intergenic
1021383929 7:20004538-20004560 CAAGTGCATAAGAATTACCGGGG - Intergenic
1021524750 7:21574722-21574744 AAAGTACAAAAAAATTACCTGGG - Intronic
1021557489 7:21935846-21935868 AAAATGCAAAAAAATTAGCCAGG + Intronic
1021570310 7:22058285-22058307 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1021610283 7:22451034-22451056 CAAATGCAAAAAAATTAGCCAGG + Intronic
1021747815 7:23760822-23760844 AAAGTACAAAAAAATTAGCCAGG - Intronic
1022010736 7:26306053-26306075 AAAATACAAAAAATTTAGCCAGG - Intronic
1022074572 7:26954637-26954659 CAAATACAAAAAAATTAGCCGGG - Intronic
1022144109 7:27520081-27520103 CACGTGCATAAATTCTACCCAGG - Intergenic
1022683938 7:32577172-32577194 AAAATACAAAAAATTTAGCCAGG + Intronic
1022759315 7:33330172-33330194 AAAATACAAAAAATTTAGCCGGG - Intronic
1022840885 7:34162884-34162906 CAAGGGATAAAAATTCACCCCGG - Intergenic
1023066493 7:36382651-36382673 AAAGTACAAAAAAATTAGCCGGG - Intronic
1023118322 7:36884160-36884182 AAAATACAAAAAAATTACCCGGG + Intronic
1023400071 7:39786339-39786361 AAAATACAAAAAATTTAGCCAGG + Intergenic
1023462552 7:40414882-40414904 CAAATACAAAAAGTTTAGCCAGG + Intronic
1023698145 7:42868267-42868289 CAAATACAAAAAAATTAGCCAGG + Intergenic
1024731733 7:52260810-52260832 AAAATACAAAAAATTTAGCCGGG + Intergenic
1024731865 7:52262165-52262187 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1024791950 7:52975136-52975158 CAAGGGAAAAAAATTTAGACTGG + Intergenic
1024858476 7:53810358-53810380 AAAATGCAAAAAAATTAGCCTGG - Intergenic
1024887265 7:54158288-54158310 TAAGAGTAAAAAATTTTCCCAGG + Intergenic
1025027080 7:55525326-55525348 AAAGTACAAAAAAATTAGCCGGG + Intronic
1025152173 7:56566592-56566614 CAAATACAAAAAAATTAGCCAGG + Intergenic
1025856437 7:65284159-65284181 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1025987736 7:66469820-66469842 CAACAACAAAAAATTTAGCCAGG - Intergenic
1025993401 7:66512825-66512847 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1026026192 7:66745606-66745628 AAAATGCAAAAAACTTAGCCAGG + Intronic
1026050987 7:66946417-66946439 AAAATGCAAAAAAATTAGCCAGG + Intronic
1026059696 7:67015160-67015182 AAAATGCAAAAAAATTAGCCAGG - Intronic
1026352356 7:69528564-69528586 AAAATGCAAAAAAATTACCCGGG - Intergenic
1026530127 7:71189969-71189991 AAAGTACAAAAAAATTAGCCAGG - Intronic
1026530889 7:71196296-71196318 AAAATACAAAAAAATTACCCAGG - Intronic
1026601014 7:71777187-71777209 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1026677443 7:72439735-72439757 CAAATACAAAAAAATTAACCAGG - Intronic
1026731493 7:72915531-72915553 AAAATACAAAAAATTTAGCCGGG - Intronic
1026733592 7:72933191-72933213 AAAATACAAAAAATTTAGCCAGG + Intronic
1026783875 7:73287744-73287766 AAAATACAAAAAATTTAGCCAGG + Intergenic
1026886074 7:73946982-73947004 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1026886435 7:73950770-73950792 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1027046682 7:74995645-74995667 AAAATACAAAAAATTTAGCCAGG + Intronic
1027110444 7:75434433-75434455 AAAATACAAAAAATTTAACCAGG - Intronic
1027288966 7:76681282-76681304 CATGTGCAAAAAAGGTACACTGG + Intergenic
1027431593 7:78119398-78119420 AAAGTACAAAAAAATTAGCCGGG + Intronic
1027448914 7:78306990-78307012 CCAGAGCACAAAATATACCCTGG + Intronic
1027593206 7:80140142-80140164 CAAATACAAAAAAATTAGCCGGG - Intronic
1027660122 7:80978857-80978879 CAAGTACAAAAAAATTAGCCGGG - Intergenic
1027910047 7:84238873-84238895 AAACTGCAAAAAAATTAGCCAGG - Intronic
1027974191 7:85128326-85128348 AAAATACAAAAAATTTAGCCAGG - Intronic
1028149056 7:87351146-87351168 AAAATGCAAAAAAATTAGCCAGG + Intronic
1028177912 7:87679251-87679273 AAAATACAAAAAAATTACCCGGG - Intronic
1028179234 7:87698258-87698280 AAAGTGCAAAGAAATTAGCCGGG - Intronic
1028247267 7:88495279-88495301 CAAGTGCTTAATATTTACCAAGG - Intergenic
1028599997 7:92590791-92590813 AAAATACAAAAAATTTAGCCCGG - Intergenic
1028662832 7:93301134-93301156 GAAATACAAAAAAATTACCCGGG + Intronic
1028782276 7:94750713-94750735 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1028825328 7:95266032-95266054 ATAGTGCAGAAAATTTACTCTGG - Intronic
1029003135 7:97177339-97177361 AAAATACAAAAAATTTACCTGGG + Intronic
1029230916 7:99067791-99067813 AAAATACAAAAAATTTAGCCAGG + Intronic
1029360156 7:100082423-100082445 AAAATACAAAAAAATTACCCGGG + Intronic
1029415289 7:100439034-100439056 CAAATACAAAAAAATTAGCCGGG + Intergenic
1029447627 7:100622796-100622818 CAAATACAAAAAATTTAGCCAGG + Intronic
1029992542 7:104975239-104975261 CAAATACAAAAAAATTAGCCAGG + Intergenic
1030027069 7:105334677-105334699 AAAATGCAAAAAAATTAGCCAGG + Intronic
1030027115 7:105335008-105335030 CAAATACAAAAAAATTAGCCAGG + Intronic
1030052062 7:105546713-105546735 AAAATACAAAAAATTTAGCCAGG + Intronic
1030210988 7:106995617-106995639 AAAATACAAAAAATTTAGCCGGG + Intergenic
1030314147 7:108097248-108097270 CAAATGGAAATTATTTACCCAGG + Intronic
1031040693 7:116835664-116835686 AAAGTACAAAAAAATTAGCCAGG - Intronic
1031210484 7:118819584-118819606 CCAGTTCAAGAAATATACCCTGG - Intergenic
1031377636 7:121047863-121047885 AAAATGCAAAAAAATTAGCCGGG - Intronic
1031444520 7:121834676-121834698 AAAATACAAAAAATTTAGCCGGG - Intergenic
1031463075 7:122076011-122076033 AAAATACAAAAAATTTAGCCGGG + Intronic
1031734620 7:125342523-125342545 AAAATACAAAAAATTTAGCCAGG + Intergenic
1031907103 7:127472556-127472578 AAAGTACAAAAAACTTAGCCAGG + Intergenic
1032304799 7:130722699-130722721 TAAGAGCAAAAAATGTAGCCTGG + Intergenic
1032387031 7:131532273-131532295 AAAGTACAAAAAAATTAGCCGGG + Intronic
1032468595 7:132162226-132162248 CATGTGCAAATACTTTCCCCAGG + Intronic
1033180036 7:139167778-139167800 CAAATACAAAAAAATTAGCCGGG + Intronic
1033264003 7:139868956-139868978 AAAGTGTAAAAAAATTAGCCGGG - Intronic
1033385984 7:140875534-140875556 AAAGTACAAAAAACTTAGCCAGG - Intronic
1033399086 7:141004904-141004926 AAAATGCAAAAAAGTTAGCCGGG - Intergenic
1033518852 7:142139498-142139520 AAAATACAAAAAAATTACCCAGG + Intronic
1033808175 7:144978174-144978196 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1033814915 7:145059887-145059909 AAAATACAAAAAATTTAGCCAGG + Intergenic
1033816594 7:145081817-145081839 CAACTTAAAAAAATTTAGCCAGG - Intergenic
1034173578 7:149082739-149082761 AAAATGCAAAAAAATTAGCCAGG - Intronic
1034187656 7:149191453-149191475 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1034438077 7:151072817-151072839 AAAATACAAAAAATTTAGCCGGG - Intronic
1034600963 7:152255325-152255347 CAAATACAAAAAAATTAGCCAGG - Intronic
1034952704 7:155311269-155311291 AAAATACAAAAAAATTACCCAGG - Intergenic
1035166722 7:156994833-156994855 AAAATGCAAAAAAATTAGCCGGG + Intronic
1035425111 7:158765573-158765595 AAATTACAAAAAATTTAGCCAGG + Intronic
1035592880 8:831054-831076 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1035914939 8:3608601-3608623 AAAATGCAAAAAAATTAGCCGGG + Intronic
1036006362 8:4668608-4668630 AAAATGCAAAAAAATTAGCCAGG - Intronic
1036147464 8:6267760-6267782 AAAATACAAAAAATTTAGCCGGG + Intergenic
1036173472 8:6513491-6513513 GAAGTACAAAAAAATTAGCCAGG - Intronic
1036280782 8:7399269-7399291 CAAATACAAAAAAATTAACCGGG + Intergenic
1036293381 8:7515552-7515574 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1036329178 8:7805444-7805466 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1036330005 8:7815085-7815107 AAAATACAAAAAAATTACCCAGG + Intronic
1036340683 8:7912303-7912325 CAAATACAAAAAAATTAACCGGG - Intergenic
1036420616 8:8592160-8592182 AAAATACAAAAAAATTACCCGGG - Intergenic
1036480046 8:9131534-9131556 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1036493941 8:9252360-9252382 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1036500426 8:9309173-9309195 AAAATACAAAAAATTTAGCCAGG - Intergenic
1037129112 8:15386058-15386080 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1037850137 8:22320749-22320771 AAAATGCAAAAAAATTAGCCAGG - Intronic
1038036716 8:23692364-23692386 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1039632350 8:39125858-39125880 CATATGCAAAAAATTTAAACTGG - Intronic
1039962835 8:42262897-42262919 AAAATACAAAAAATTTAGCCAGG - Intergenic
1039995441 8:42528299-42528321 AAAGTACAAAAAAGTTAGCCGGG + Intronic
1040564271 8:48552084-48552106 AAAGTGCAAAAAAATTACAGTGG + Intergenic
1040776437 8:51049081-51049103 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1040843847 8:51814587-51814609 CAAATACAAAAAAATTAGCCAGG + Intergenic
1041046457 8:53891458-53891480 AAAATGCAAAAAAATTAGCCAGG + Intronic
1041157645 8:55004761-55004783 AAAATACAAAAAAATTACCCGGG + Intergenic
1041595985 8:59653643-59653665 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1041856933 8:62467928-62467950 AAAATGCAAAAAAATTAGCCAGG - Intronic
1041920370 8:63176438-63176460 AAAATACAAAAAAATTACCCGGG - Intronic
1042044079 8:64628485-64628507 AAACTGCAAAAAATTTAGCTGGG + Intronic
1042146828 8:65738588-65738610 AAAATACAAAAAAATTACCCAGG - Intronic
1042284056 8:67088446-67088468 AAAGTACAAAAAAATTAGCCAGG - Intronic
1043321082 8:78987636-78987658 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1043328529 8:79083705-79083727 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1043454732 8:80402057-80402079 AAAATACAAAAAAATTACCCGGG - Intergenic
1043865308 8:85368326-85368348 AAAATACAAAAAAATTACCCGGG - Intronic
1044082335 8:87900947-87900969 AAAATACAAAAAAATTACCCAGG - Intergenic
1045089090 8:98720588-98720610 AAAGTACAAAAAAATTAGCCAGG + Intronic
1045134274 8:99196596-99196618 AAAATACAAAAAACTTACCCAGG - Intronic
1045216800 8:100157382-100157404 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1045242902 8:100417834-100417856 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1045301671 8:100916337-100916359 AAAATACAAAAAATTTAGCCGGG - Intergenic
1045851262 8:106701322-106701344 CAAGTGAAAAAAAGTTACTGCGG - Intronic
1045919201 8:107510359-107510381 AAAATACAAAAAATTTAGCCGGG - Intergenic
1046054047 8:109058353-109058375 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1046269957 8:111881853-111881875 CAAGTGCAATAAAATGACCTAGG - Intergenic
1046295298 8:112211625-112211647 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1046548647 8:115683898-115683920 CAAATACAAAAAAATTAGCCAGG + Intronic
1046645197 8:116778166-116778188 AAAATACAAAAAAATTACCCGGG + Intronic
1046789342 8:118304597-118304619 AAAATACAAAAAAATTACCCGGG + Intronic
1046932815 8:119858021-119858043 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1047107248 8:121746153-121746175 AAAATACAAAAAATTTAGCCGGG + Intergenic
1047212386 8:122850477-122850499 AAAGTACAAAAAAATTAGCCAGG + Intronic
1047272292 8:123373626-123373648 CAAATACAAAAAAATTAGCCAGG + Intronic
1047273084 8:123381338-123381360 AAATTGCAAAAAAATTAGCCAGG + Intronic
1047674782 8:127188804-127188826 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1047734978 8:127757296-127757318 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1047812212 8:128423188-128423210 AAAATACAAAAAATTTAGCCGGG + Intergenic
1048267631 8:133001416-133001438 CAAGTGTAAAGAATTTCTCCTGG + Intronic
1048722927 8:137347671-137347693 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1048930178 8:139308720-139308742 AAAGTACAAAAAACTTAGCCGGG - Intergenic
1049074255 8:140381505-140381527 AAAGTGCAAAAAAATTAGCTGGG + Intronic
1049149523 8:141025624-141025646 AAAGTACAAAAAAATTAGCCTGG + Intergenic
1049262080 8:141645259-141645281 AAAATACAAAAAATTTAGCCAGG - Intergenic
1049278619 8:141732621-141732643 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1049628620 8:143638575-143638597 AAAATGCAAAAAAATTAGCCGGG + Intronic
1049740211 8:144236580-144236602 AAAATACAAAAAATTTAGCCAGG + Intronic
1049906310 9:220307-220329 CAAATGAAGAAAATTCACCCTGG - Intronic
1049916053 9:319916-319938 AATGTGCAGAAAATTTGCCCAGG + Intronic
1049949477 9:630388-630410 AAAGTTCAAAAAAATTAGCCAGG + Intronic
1049957126 9:703870-703892 AAAATGCAAAAAATTTAGCTGGG - Intronic
1050054815 9:1640633-1640655 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1050344486 9:4672935-4672957 AAAATGCAAAAAACTTAGCCGGG + Intergenic
1050355055 9:4774770-4774792 CAAATACAAAAAAATTAGCCAGG + Intergenic
1050386733 9:5098852-5098874 AAAATACAAAAAAATTACCCAGG - Intronic
1050541733 9:6676214-6676236 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1050814176 9:9788389-9788411 AAAATACAAAAAAATTACCCGGG + Intronic
1050914143 9:11109778-11109800 GAAGGAAAAAAAATTTACCCTGG + Intergenic
1051065962 9:13103350-13103372 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1051302176 9:15663764-15663786 AAAGTACAAAAAAATTAGCCAGG - Intronic
1051444585 9:17126888-17126910 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1051572149 9:18571224-18571246 AACGTGCAGAAAATTTTCCCTGG + Intronic
1052696024 9:31879600-31879622 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1052925664 9:34014164-34014186 AAAATGCAAAAAAGTTAGCCGGG + Intronic
1053162005 9:35819651-35819673 TAAATACAAAAAATTTAGCCAGG - Intronic
1053242488 9:36507414-36507436 AAAATACAAAAAAATTACCCGGG - Intergenic
1053864469 9:42422694-42422716 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1054593453 9:67037627-67037649 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1054969539 9:71069335-71069357 AAAATGCAAAAAATTTAGCCAGG - Intronic
1055012479 9:71581948-71581970 AAAATACAAAAAATTTAGCCAGG - Intergenic
1055097551 9:72429051-72429073 AAAATACAAAAAATTTAGCCAGG - Intergenic
1055229851 9:74049398-74049420 AAAATACAAAAAATTTAGCCAGG - Intergenic
1055612353 9:78035804-78035826 CAAGCTCAAAAAACGTACCCGGG + Intergenic
1055660695 9:78501256-78501278 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1055802980 9:80060774-80060796 AAAGTACAAAAAATTTAGCTGGG - Intergenic
1055968488 9:81888428-81888450 AAAGTACAAAAAACTTAGCCAGG + Intergenic
1056517214 9:87365438-87365460 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1056603693 9:88067295-88067317 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1056903210 9:90620595-90620617 AAAATACAAAAAAATTACCCAGG + Intronic
1057069055 9:92080281-92080303 CAAATGCAGAAAAGTTAACCAGG - Intronic
1057137513 9:92703642-92703664 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1057289948 9:93799361-93799383 AAAATACAAAAAATTTAGCCAGG - Intergenic
1057548157 9:96033403-96033425 AAAATGCAAAAAATTTAGCCAGG - Intergenic
1057924636 9:99133841-99133863 AAAATGCAAAAAAATTAGCCGGG + Intronic
1058036927 9:100262905-100262927 AAAATACAAAAAATTTAGCCAGG - Intronic
1058516861 9:105784817-105784839 CAAATGCTAAAAAACTACCCTGG - Intergenic
1058683169 9:107457583-107457605 AAAATACAAAAAATTTAGCCAGG + Intergenic
1058865299 9:109156547-109156569 AAAGTACAAAAAAATTAGCCGGG - Intronic
1058925044 9:109655133-109655155 AAAGTACAAAAAAATTAGCCGGG + Intronic
1059420742 9:114190429-114190451 CAAAAGCAAAAAATTTAGCTGGG - Intronic
1059544293 9:115160775-115160797 CAAGTGCAAAACATCTCCCCAGG - Intronic
1059697547 9:116743388-116743410 AAAATGCAAAAAAATTAGCCAGG + Intronic
1059865978 9:118514301-118514323 AAAATACAAAAAATTTAGCCGGG + Intergenic
1060135487 9:121149273-121149295 TAAGTGAAAAAGATTTACTCAGG - Intronic
1060295791 9:122342169-122342191 AAAGTGCAAACAATTTAGCATGG + Intergenic
1060382130 9:123185869-123185891 AAAATGCAAAAAAATTAGCCGGG + Intronic
1060427719 9:123520296-123520318 AAAGTACAAAAAAATTAGCCGGG + Intronic
1060507900 9:124212046-124212068 AAAATACAAAAAAATTACCCAGG + Intergenic
1060768174 9:126310518-126310540 AAAATACAAAAAATTTAGCCAGG - Intergenic
1060933319 9:127502524-127502546 AAAATACAAAAAATTTAGCCAGG + Intronic
1061198115 9:129119564-129119586 AAAGTACAAAAAAATTAGCCAGG - Intronic
1061361909 9:130148876-130148898 AAAATACAAAAAATTTAGCCGGG + Intergenic
1061549335 9:131324298-131324320 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1061672404 9:132196349-132196371 AAAATACAAAAAAATTACCCGGG - Intronic
1061984523 9:134122288-134122310 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1062336224 9:136070345-136070367 AAAATGCAAAAAAATTAGCCGGG + Intronic
1202786974 9_KI270719v1_random:34431-34453 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1185508939 X:648383-648405 AAAATGCAAAAAAATTACCCAGG - Intronic
1185669963 X:1800194-1800216 AAAATACAAAAAAATTACCCAGG + Intergenic
1185979423 X:4760116-4760138 AAAATACAAAAAATTTAGCCAGG - Intergenic
1185984470 X:4815824-4815846 AAAATACAAAAAATTTAGCCAGG + Intergenic
1186040831 X:5476203-5476225 AAAATACAAAAAATTTAGCCGGG + Intergenic
1186040897 X:5476971-5476993 AAAATACAAAAAATTTAGCCAGG - Intergenic
1186889052 X:13942231-13942253 CAAAAGCAAAAAACTTAGCCAGG + Intergenic
1186978404 X:14933129-14933151 CAAATACAAAAAAATTAACCAGG + Intergenic
1186985405 X:15008525-15008547 CAAATACAAAAAAATTAGCCGGG - Intergenic
1187342161 X:18431020-18431042 AAAATGCAAAAAAATTAGCCAGG - Intronic
1187383120 X:18823464-18823486 AAAGTACAAAAAAATTAGCCGGG + Intronic
1187864300 X:23710047-23710069 AAAGTACAAAAAAATTAGCCAGG - Intronic
1187898323 X:24003390-24003412 AAAATGCAAAAAAATTAGCCGGG + Intronic
1187914909 X:24144357-24144379 CAAGTACAAAAAAATTAGCCAGG - Intergenic
1187947400 X:24439735-24439757 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1187963779 X:24590951-24590973 AAAGTACAAAAAAATTAGCCTGG - Intronic
1188366400 X:29320614-29320636 AAAATACAAAAAAATTACCCGGG + Intronic
1188967478 X:36572581-36572603 AAAATACAAAAAAATTACCCAGG + Intergenic
1189444940 X:41072153-41072175 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1190221452 X:48514908-48514930 CAATTGTAAAAAAATTAGCCAGG + Intronic
1190497646 X:51041906-51041928 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1190570147 X:51772751-51772773 AAAATACAAAAAAATTACCCAGG - Intergenic
1190757068 X:53410430-53410452 AAACTACAAAAAATTTAGCCAGG + Intronic
1190799359 X:53773080-53773102 TAAATGCAAAAAAATTAGCCAGG - Intergenic
1190813124 X:53904155-53904177 AAAATACAAAAAATTTAGCCGGG + Intergenic
1190821561 X:53978104-53978126 AAAATACAAAAAATTTAGCCAGG - Intronic
1191222143 X:58000986-58001008 CAAGTGAAAATAATTTTCTCTGG - Intergenic
1191238542 X:58158514-58158536 CAAATACAAAAAAATTAGCCAGG - Intergenic
1191593956 X:62922425-62922447 AAAATACAAAAAATTTAACCAGG + Intergenic
1191596698 X:62952101-62952123 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1192374251 X:70543019-70543041 AAAATGCAAAAAAATTAGCCGGG + Intronic
1192535712 X:71925517-71925539 GAAGTGCAAAAACATAACCCAGG - Intergenic
1192638611 X:72843611-72843633 AAAGTACAAAAAAATTAGCCGGG + Intronic
1192643103 X:72877197-72877219 AAAGTACAAAAAAATTAGCCGGG - Intronic
1192791650 X:74387998-74388020 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1193101661 X:77621468-77621490 AAAATGCAAAAAAATTAGCCAGG - Intronic
1193383423 X:80843470-80843492 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1193602562 X:83525994-83526016 AAAGTACAAAAAAATTAACCAGG + Intergenic
1193633547 X:83920142-83920164 AAAATACAAAAAAATTACCCGGG - Intergenic
1193821125 X:86166099-86166121 AAGGTGCCAAAAATATACCCTGG - Intronic
1194001865 X:88439706-88439728 AAAATACAAAAAATTTAGCCAGG - Intergenic
1194633823 X:96319920-96319942 AAAATACAAAAAATTTAGCCAGG - Intergenic
1194678157 X:96818137-96818159 AAAATACAAAAAATTTAGCCGGG - Intronic
1194721655 X:97347247-97347269 AAAGTACAAAAAAATTAGCCAGG - Intronic
1194796202 X:98214207-98214229 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1195044014 X:101039737-101039759 CAAATACAAAAAAATTAGCCAGG + Intronic
1195074157 X:101310559-101310581 AAAATACAAAAAAATTACCCGGG - Intergenic
1195516006 X:105776795-105776817 CTAATGCAAAAAAATTAGCCTGG - Intergenic
1195844451 X:109210563-109210585 AAAGTACAAAAAAATTATCCTGG - Intergenic
1195929672 X:110062150-110062172 TTATTGCAAAAAATTTTCCCAGG - Intronic
1196111311 X:111950162-111950184 CAAATACAAAAAAATTAGCCAGG + Intronic
1196436745 X:115681527-115681549 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1196727425 X:118908878-118908900 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1196782446 X:119395660-119395682 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1196822791 X:119715832-119715854 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1196910974 X:120484094-120484116 AAAGTACAAAAAAATTAGCCAGG - Intergenic
1197323623 X:125064765-125064787 AAATTACAAAAAATTTAGCCAGG - Intergenic
1197485765 X:127049461-127049483 AAAATACAAAAAATTTAGCCAGG - Intergenic
1197613047 X:128660175-128660197 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1197663915 X:129202683-129202705 AAAGTGCAAAAAAATTAGCCAGG - Intergenic
1197885287 X:131211424-131211446 AAAATACAAAAAATTTACCCGGG - Intergenic
1198045359 X:132896308-132896330 AAAATACAAAAAAATTACCCAGG + Intronic
1198083768 X:133264196-133264218 CAAATACAAAAAAATTAGCCAGG - Intergenic
1198114801 X:133534816-133534838 AAAATACAAAAAATTTAGCCAGG - Intergenic
1198153481 X:133934023-133934045 AAAATACAAAAAATTTAGCCGGG - Intronic
1198371107 X:135990144-135990166 AAATTACAAAAAATTTAGCCAGG - Intronic
1198924407 X:141771580-141771602 AAAGTACAAAAAAATTAGCCGGG + Intergenic
1198924483 X:141772303-141772325 AAAGTACAAAAAAATTAGCCAGG + Intergenic
1199674453 X:150174913-150174935 AAAATACAAAAAATTTAGCCGGG - Intergenic
1199722443 X:150551582-150551604 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1200039374 X:153354721-153354743 CAAGTGCACAAATCCTACCCAGG - Intronic
1200172640 X:154088986-154089008 CAAATACAAAAAAATTAGCCAGG + Intronic
1200241205 X:154495018-154495040 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1200311616 X:155084521-155084543 AAAATGCAAAAAAATTAGCCGGG - Intronic
1201328395 Y:12791928-12791950 CAATTACCAAAAATTTACACAGG - Intronic
1201746549 Y:17380886-17380908 AAAGTACAAAAAAATTGCCCAGG + Intergenic
1201976947 Y:19861476-19861498 AAAATACAAAAAATTTAGCCGGG - Intergenic
1202046010 Y:20738003-20738025 AAAGTACAAAAAAATTAGCCGGG - Intergenic
1202280085 Y:23174807-23174829 AAAATACAAAAAATTTAGCCAGG - Intronic
1202280814 Y:23185652-23185674 AAAATACAAAAAATTTAGCCAGG - Intronic
1202436750 Y:24847255-24847277 AAAATACAAAAAATTTAGCCAGG + Intronic
1202588382 Y:26456204-26456226 AAAATGCAAAAAAATTAGCCGGG - Intergenic