ID: 930126084

View in Genome Browser
Species Human (GRCh38)
Location 2:47797981-47798003
Sequence CATTATGAAGGAAGCAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 295}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930126084_930126087 -10 Left 930126084 2:47797981-47798003 CCCACTCTGCTTCCTTCATAATG 0: 1
1: 0
2: 0
3: 26
4: 295
Right 930126087 2:47797994-47798016 CTTCATAATGCTGCTTTCCCTGG 0: 1
1: 0
2: 6
3: 25
4: 200
930126084_930126088 -9 Left 930126084 2:47797981-47798003 CCCACTCTGCTTCCTTCATAATG 0: 1
1: 0
2: 0
3: 26
4: 295
Right 930126088 2:47797995-47798017 TTCATAATGCTGCTTTCCCTGGG 0: 1
1: 3
2: 4
3: 36
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930126084 Original CRISPR CATTATGAAGGAAGCAGAGT GGG (reversed) Intronic
900189779 1:1348528-1348550 CAGTGGGAAGGAAGCAGGGTGGG - Intronic
900379120 1:2375075-2375097 TGTTATGAAGGAGGCAGAGTTGG - Intronic
900739527 1:4322253-4322275 TATTATGAGGGAAGGAGGGTGGG - Intergenic
902453570 1:16515255-16515277 CACTGTGAAGTAAGCAAAGTTGG + Intergenic
902473625 1:16667919-16667941 CACTGTGAAGTAAGCAAAGTTGG + Intergenic
902485178 1:16739523-16739545 CACTGTGAAGTAAGCAAAGTTGG - Intergenic
902498912 1:16895007-16895029 CACTGTGAAGTAAGCAAAGTTGG - Intronic
903080816 1:20810862-20810884 CACTCTGAAGGTAGAAGAGTCGG + Exonic
903179975 1:21600299-21600321 CAGTATGCAGGAGCCAGAGTGGG - Intronic
904432833 1:30476228-30476250 CATTCTGAAGGAAGGACAGGAGG - Intergenic
908703100 1:66923566-66923588 CTTTTTGAATGAAGCAGTGTCGG - Intronic
909184324 1:72466499-72466521 GATTTTGAAGGAAGGAGAGTAGG - Intergenic
909754860 1:79212554-79212576 AATGGTGAAGGAAGTAGAGTAGG - Intergenic
910019387 1:82568386-82568408 CATTTTAAAGGATGCAGAGGGGG + Intergenic
910852065 1:91658160-91658182 CAGTATGGTGGCAGCAGAGTTGG - Intergenic
911479782 1:98423508-98423530 CATGATGAAGAAAGCATAGAGGG - Intergenic
911500037 1:98674332-98674354 CATCAAGAAGTCAGCAGAGTTGG + Intronic
911936324 1:103978758-103978780 CATAATTAAAGAAGCAGATTTGG + Intergenic
913461244 1:119088164-119088186 CATTATGAATGAAAAAGAGAAGG + Intronic
914389055 1:147202009-147202031 CTCTATGAAGGAAGCAGAATAGG + Intronic
914517876 1:148389613-148389635 CACTGTGAAGTAAGCAAAGTTGG + Intergenic
914935411 1:151974825-151974847 CATTTTTAAAGAAGCAGTGTAGG + Intergenic
915281394 1:154824744-154824766 CATTTTAAAGGAAGCAGTGAAGG + Intronic
915593393 1:156883036-156883058 CATGGTGAGGGATGCAGAGTTGG + Intergenic
915812230 1:158925485-158925507 CATTATAAAGGCAGCAGAGGAGG + Intergenic
916032016 1:160885194-160885216 CTTTATGGAGGAAGCCCAGTGGG + Intergenic
916560596 1:165931335-165931357 TATTGTGAAGGCAGCAGGGTAGG - Intergenic
916627507 1:166574119-166574141 AAGTATGGAGGAATCAGAGTTGG - Intergenic
917087279 1:171316616-171316638 GATTTTGGAGGCAGCAGAGTTGG - Intronic
918026394 1:180753118-180753140 CATTTTGTAGTAAGCAAAGTTGG - Intronic
918758586 1:188371300-188371322 CTTTGTGAAGAAAGCAGAGAGGG - Intergenic
919503642 1:198370024-198370046 CATGATGAAGGCAGGAGATTAGG + Intergenic
919836284 1:201575757-201575779 TATTATGAAGGAAGGAGGGAAGG + Intergenic
919956480 1:202421954-202421976 CATTATGAAGTAGGCAATGTGGG - Intronic
920352501 1:205346772-205346794 CCTTATGAAGGAAACCAAGTGGG + Intronic
921829736 1:219713747-219713769 CAGTATGAAGGATGCTGAGATGG - Intronic
922465234 1:225842101-225842123 CAGTTTGAAGGAAGCTGAGCAGG + Intronic
923295027 1:232585986-232586008 AACTATGAAGGAAATAGAGTTGG + Intergenic
1065746081 10:28843650-28843672 CAATATGAAGGAAGGATAGATGG - Intergenic
1066205495 10:33185416-33185438 CATTATGAAGGACCTAGGGTAGG + Intronic
1067310271 10:45106340-45106362 CATTATGCAGGGAGCTGAGCAGG + Intergenic
1069155638 10:65027557-65027579 AACTAAGAAGGAAGCAGATTTGG + Intergenic
1069588798 10:69629683-69629705 CATCAGGAAGGAGGCAGAGGTGG + Intergenic
1070741400 10:78905630-78905652 CTCTGTGAAGGAGGCAGAGTGGG + Intergenic
1070957341 10:80473225-80473247 CATCAGGAAAGCAGCAGAGTGGG - Intronic
1071011379 10:80944540-80944562 CAGTGGGATGGAAGCAGAGTTGG + Intergenic
1073200211 10:101729207-101729229 AATGAGGAAGGAAGCAGAATTGG + Intergenic
1074108053 10:110403243-110403265 CATTCTGAAGATGGCAGAGTAGG - Intergenic
1074305698 10:112276133-112276155 AATTATTAAGCAAGGAGAGTGGG + Intergenic
1075053136 10:119198096-119198118 TATTAAGTAGGAAGCATAGTTGG - Intergenic
1077662664 11:4083421-4083443 CATGATGAAGTGAGCAGGGTTGG - Exonic
1077704280 11:4469079-4469101 CAGAATGAAGGACTCAGAGTAGG - Intergenic
1079782121 11:24620517-24620539 CATTAAAAAGTAAGCAGTGTAGG - Intronic
1080721748 11:34855949-34855971 CATTATAAAGGCATCAGGGTTGG - Intronic
1081202898 11:40239607-40239629 CATTACTAAGGGAGAAGAGTTGG - Intronic
1081377243 11:42374480-42374502 CATCATGAAGAGAGCAGAATAGG - Intergenic
1081951563 11:47048472-47048494 AATTATGAAGGAAGGAAAGAAGG + Intronic
1081988067 11:47321577-47321599 CATTATGAAAGAAGCTCAGGGGG + Intronic
1083188221 11:61030528-61030550 CAGTCAGAAGGAAGCAGAATGGG - Intergenic
1083738794 11:64696809-64696831 CATGAAGAAGGCAGCAGAGCAGG - Intronic
1084771020 11:71343109-71343131 CAAGATCAAGGCAGCAGAGTTGG - Intergenic
1085625641 11:78070324-78070346 CATCATCTATGAAGCAGAGTGGG + Intronic
1086039773 11:82462245-82462267 CATTATTTTGGAAGCAGAGAAGG + Intergenic
1086293478 11:85337744-85337766 CATTGTGAAAGAAGCAGAAATGG - Intronic
1086438738 11:86807241-86807263 CATCATGAAGGTAGAAGAGGAGG + Intronic
1086936291 11:92748660-92748682 CAGAATGAGGAAAGCAGAGTGGG + Intronic
1088341603 11:108774451-108774473 CTTGCTGGAGGAAGCAGAGTTGG + Intronic
1088707415 11:112476309-112476331 CAAAATGAAGGAGACAGAGTCGG - Intergenic
1089577054 11:119452300-119452322 CATTATGAAGGAGCCATTGTTGG + Intergenic
1089904790 11:122027445-122027467 CATTTTGAAGGAACCTGTGTGGG + Intergenic
1092721422 12:11444762-11444784 CATAAAGAAGGAAGGAGAGGAGG + Intronic
1093272682 12:17083377-17083399 CATCATCAAGATAGCAGAGTAGG - Intergenic
1095462406 12:42456567-42456589 CCCTGTGAAGGAAGCAGAGGGGG - Intronic
1095858768 12:46891328-46891350 CATGATGAAAAAACCAGAGTAGG - Intergenic
1095952550 12:47789760-47789782 CACAAAGGAGGAAGCAGAGTGGG - Intronic
1096222070 12:49836603-49836625 CATTTTAAAGGAAGCAGTGTTGG - Exonic
1097689566 12:62721782-62721804 CATTATGAAAACAGCAGTGTGGG - Intronic
1097914463 12:65005773-65005795 TTTTATGAAGAAATCAGAGTAGG - Intergenic
1099679564 12:85807581-85807603 TATCATAAAGGAATCAGAGTTGG + Intronic
1099717027 12:86309028-86309050 CATTATTATGGAAGCAGAATGGG - Intronic
1099776420 12:87137311-87137333 CAATTTTAAGGAAGCAGAATAGG + Intergenic
1099914761 12:88878383-88878405 CTGTAGGAAGGAAGCAGAGCAGG + Intergenic
1099945198 12:89235884-89235906 CAGTATGGAGGAAGGAGAGGAGG - Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102287389 12:111669520-111669542 CATTAAGAGGGAAGCAAAGCCGG - Intronic
1102545999 12:113656035-113656057 CATTTTCCAGGAAGCAGGGTGGG - Intergenic
1103025579 12:117571283-117571305 CATTGTGGAGGAAGCAAGGTTGG + Intronic
1103449595 12:121019182-121019204 CATTATGAAGGACACAAAGATGG + Intergenic
1103472761 12:121194995-121195017 CAATATGAATGGAGCATAGTGGG - Intergenic
1104671685 12:130685173-130685195 TATTATTAATGAAGCAGAGTGGG - Intronic
1104825674 12:131707581-131707603 CACTTTGAAGGAAGAAGGGTGGG - Intergenic
1105489322 13:20872257-20872279 GTTGATGAAGGAAGCAGAGACGG - Intronic
1105573059 13:21622390-21622412 CTTTATGAAGGGAGAAGAGATGG + Intergenic
1105767164 13:23573025-23573047 CTTTATGAAATAAGCAGAATTGG + Intronic
1106206441 13:27600651-27600673 CAATCTAGAGGAAGCAGAGTTGG - Intronic
1106465974 13:30015002-30015024 CAGTATGAAGGAAGGGGAGCTGG + Intergenic
1106472737 13:30072089-30072111 CACTGTTAAGGAAGCAGAGCTGG + Intergenic
1107380973 13:39856406-39856428 AATGATGAAGGAAACACAGTGGG + Intergenic
1108429573 13:50340574-50340596 CATTATGTAGCAAACAGAATTGG + Intronic
1109759650 13:66811446-66811468 CATTATTATGGAAGCTGAATGGG - Intronic
1110125998 13:71942811-71942833 CATTATGATGGAAGGAGAAGAGG - Intergenic
1110263350 13:73511194-73511216 CAATCTGAAGGAAGGAGAGCAGG - Intergenic
1112357351 13:98684914-98684936 CACTTTGAAGAAATCAGAGTTGG + Exonic
1112889987 13:104217888-104217910 CATGATGAGGGAAGAAGTGTAGG - Intergenic
1113200259 13:107859601-107859623 CAGTATTAAAGAATCAGAGTAGG + Intronic
1115355545 14:32442864-32442886 AATTTTGAAGACAGCAGAGTGGG - Intronic
1119246894 14:73117877-73117899 CCTTCAGAAGGGAGCAGAGTAGG + Intronic
1119389524 14:74281554-74281576 AGTTGAGAAGGAAGCAGAGTGGG - Intergenic
1120451945 14:84679941-84679963 CAATATGAAAGAAGCTGAGTGGG + Intergenic
1120650087 14:87121948-87121970 CATGATCAAGTAACCAGAGTTGG + Intergenic
1121135767 14:91497153-91497175 CATTAAGAGGGAGGCAGAGAAGG + Intronic
1121171156 14:91855467-91855489 CACAAAGATGGAAGCAGAGTTGG - Intronic
1121472634 14:94167181-94167203 ATTCATGAAGGAAGCAGAATGGG + Intronic
1122224879 14:100269396-100269418 CATTATGAATGAGGCAGTATGGG - Intronic
1122680708 14:103459965-103459987 CATGGTGAAGGAAGCAGAAGGGG - Intronic
1123504732 15:20929529-20929551 CATTATGAAGCATGCTGTGTTGG + Intergenic
1123561979 15:21503230-21503252 CATTATGAAGCATGCTGTGTTGG + Intergenic
1123598223 15:21940511-21940533 CATTATGAAGCATGCTGTGTTGG + Intergenic
1125231202 15:37458283-37458305 CATTATGATGGAAATAGTGTTGG - Intergenic
1127603774 15:60565525-60565547 CATTATGAATGAGACAGAGTTGG - Intronic
1127784189 15:62341867-62341889 GACTTTGAAGGAAGCAGAGGTGG + Intergenic
1129907304 15:79197469-79197491 CATTGTAAAGGCAGCAGACTGGG + Intergenic
1130169496 15:81497106-81497128 CCTTAAGAAGGAAGAAGCGTGGG - Intergenic
1130371921 15:83292143-83292165 CATTATACAGGAAACAGACTTGG + Intergenic
1130884330 15:88080849-88080871 CATTGGGAAGGAAGGAAAGTGGG + Intronic
1131564570 15:93474339-93474361 CATTTTGAATTGAGCAGAGTTGG - Intergenic
1202970324 15_KI270727v1_random:230356-230378 CATTATGAAGCATGCTGTGTTGG + Intergenic
1134325191 16:13201037-13201059 GGTTATGAGGGAAGCAGTGTAGG + Intronic
1134341091 16:13346933-13346955 CAGCATGAAGGAAGAAAAGTAGG - Intergenic
1135869949 16:26140457-26140479 GATTAAGAAGGAAGAAGAGGAGG + Intergenic
1136091656 16:27925084-27925106 CCTTCTGGAGGAAGGAGAGTAGG + Intronic
1137717681 16:50608741-50608763 CATGATGGAGGAAACAGAATAGG - Intronic
1140360186 16:74337435-74337457 CATGTTGGAGGAAGCAGAGCGGG + Intergenic
1141070809 16:80952973-80952995 TATTATGAAGAAAGCAGACATGG - Intergenic
1141157724 16:81609093-81609115 CACTAAGAAGAAAGCAGACTGGG - Intronic
1141218564 16:82047657-82047679 CTTTATGAAGGAAGCCCTGTAGG + Intronic
1145886112 17:28383658-28383680 CACGATGAAGGACACAGAGTGGG - Intronic
1146635803 17:34503631-34503653 CAGCATGAAGGAAGCAGAGGAGG + Intergenic
1146791221 17:35751689-35751711 CATCATAAAGGAAGGAGATTTGG - Intronic
1147979824 17:44267706-44267728 CATTAGGAAGGAAGGAGTCTGGG + Intronic
1148078464 17:44953801-44953823 CATTCTGCAGGCAACAGAGTAGG + Intergenic
1148728905 17:49818487-49818509 GATTATGAAAGTAGCAGAGTGGG + Intronic
1150392423 17:64797822-64797844 CATAATGGAAGCAGCAGAGTAGG + Intergenic
1151469717 17:74310282-74310304 CATTTTGGGGGAAGCAGTGTGGG + Intronic
1152150418 17:78596613-78596635 CATTATGCAGGAGGCTGAGGTGG - Intergenic
1154204232 18:12323824-12323846 CATTATGCAGAAAACAGACTAGG + Intronic
1155638494 18:27983754-27983776 CATTTTGAAGGAAACTGAATTGG - Intronic
1155920444 18:31598065-31598087 CATTCTGATGGAACCATAGTAGG - Intronic
1155929258 18:31688790-31688812 CAGTATAAAGGTAGCAGAGCTGG + Intergenic
1155982288 18:32194042-32194064 CTTTATGAAGACAGGAGAGTGGG - Intronic
1157742632 18:50106937-50106959 CTTAGTGAAGGCAGCAGAGTGGG - Intronic
1159782949 18:72680502-72680524 CATAATGAATTAAGCAGATTTGG + Intergenic
1160008992 18:75089517-75089539 CATAGTGAAGGAAGCAGGGATGG - Intergenic
1161900604 19:7116287-7116309 CAATAAGAAGGAAGGAGAGAGGG + Intronic
1162764790 19:12912330-12912352 CATTATGAAGGAGGCAGGAAGGG - Intronic
1164546698 19:29171418-29171440 CAAAAAGAAGGAAGCAGACTAGG + Intergenic
1166996940 19:46723949-46723971 CATGATCAAGGAGGCAGAGCCGG + Intronic
1168384157 19:55948993-55949015 CAATATGAATAAAGCAGAGCTGG + Intronic
1168487657 19:56778280-56778302 AATAATGAAGAAACCAGAGTAGG + Intronic
1202705816 1_KI270713v1_random:22994-23016 CACTGTGAAGTAAGCAAAGTTGG + Intergenic
925033488 2:670036-670058 CATTATGAAGAAAACACACTGGG + Intronic
925738693 2:6986302-6986324 CATAATGGAGGTAACAGAGTAGG - Intronic
926011369 2:9410821-9410843 CATTTTGGGGGAGGCAGAGTAGG - Intronic
926347135 2:11957671-11957693 CTGTGTGAAGGAAGTAGAGTGGG + Intergenic
926972157 2:18477165-18477187 AACTTTGCAGGAAGCAGAGTCGG + Intergenic
927136586 2:20101136-20101158 CATTATGGGGCATGCAGAGTAGG - Intergenic
927985341 2:27406395-27406417 CACTATCAATGAAGCAGAATAGG + Intronic
928846538 2:35680517-35680539 TTATATGAAGGAAGCAGTGTTGG + Intergenic
929045056 2:37781049-37781071 CTTGAAGAAGGATGCAGAGTTGG - Intergenic
930126084 2:47797981-47798003 CATTATGAAGGAAGCAGAGTGGG - Intronic
930365575 2:50435281-50435303 CATTATAAATGAAGCAGGGAGGG - Intronic
931607152 2:64064105-64064127 CAGGATGAAAGAAGCAGAGCCGG + Intergenic
931640078 2:64374325-64374347 CATGCTGCAGAAAGCAGAGTTGG + Intergenic
932050365 2:68392214-68392236 CATGATGAAGGAAGAAGAAGAGG - Intronic
932881148 2:75503337-75503359 AATTACCCAGGAAGCAGAGTGGG + Intronic
935131771 2:100265949-100265971 CATTGTGAAGGACGCAGCATGGG - Intergenic
935453110 2:103233732-103233754 CCTAATGGAGGAAGTAGAGTAGG - Intergenic
935995372 2:108765702-108765724 CACTAAGAAGGAAGGACAGTGGG + Exonic
936902533 2:117498435-117498457 AATTATGAAAGAGGCTGAGTTGG + Intergenic
939133290 2:138263317-138263339 TAAAATGAAGGAATCAGAGTAGG + Intergenic
939844222 2:147223712-147223734 CATTCTGAAAGAATGAGAGTTGG - Intergenic
940404836 2:153288725-153288747 CTTTATGAATCAGGCAGAGTAGG - Intergenic
942665136 2:178309448-178309470 CATGAGGAAGGAAGAAGAGAAGG - Intronic
942809753 2:179984050-179984072 CACTATGAAGTAAGCAGGCTAGG - Intronic
943162809 2:184277517-184277539 CATTGTGAAGGAAGCAGGATTGG + Intergenic
943387733 2:187223478-187223500 TTTTATGAAGGAAATAGAGTAGG - Intergenic
943687265 2:190831620-190831642 CAAAATGAAGGATGAAGAGTAGG + Intergenic
944302017 2:198134347-198134369 CATTGTGGAGGAAGCTGAGTTGG + Intronic
945369623 2:209000910-209000932 CGTGATGAAGGAAGCAGAGGTGG - Intergenic
945633652 2:212318844-212318866 CATAATGAAGGAGACAGAGAAGG + Intronic
946390826 2:219416153-219416175 CAATATGTAAGAAGCAGAGGAGG - Intergenic
946411356 2:219516828-219516850 CATTGTGCAGGGAGAAGAGTCGG + Intronic
948658092 2:239489264-239489286 CATAATTAAGGAAGCAGATGGGG + Intergenic
1168791095 20:576485-576507 CATTATGAAGGAACCAAATAGGG + Intergenic
1171036929 20:21720856-21720878 CTTTATGCAGGAAGCAGTTTAGG + Intergenic
1171169837 20:23006292-23006314 CCTTATCATGGAAACAGAGTAGG - Intergenic
1173555824 20:43964890-43964912 CATGATGTAGGAAGCAAAGGAGG - Intronic
1175014635 20:55776436-55776458 CACTCTGAAGGAAACAGAGAGGG + Intergenic
1179530461 21:42015078-42015100 CTTTATGAAAGAGGCAGAGAAGG - Intergenic
1180482127 22:15763753-15763775 CATTAACAAGAAAGCAGGGTGGG + Intergenic
1182853006 22:33492542-33492564 CAGTAAACAGGAAGCAGAGTGGG + Intronic
1183022747 22:35040264-35040286 CATTCTTAAGGAAGCAGTGCAGG + Intergenic
1183606581 22:38870066-38870088 AACTATGAAGGCTGCAGAGTTGG - Intronic
1184411565 22:44329150-44329172 CACTCTCAAGGAAGCAGAGGAGG - Intergenic
949571365 3:5296481-5296503 CATTATGAGTGAACTAGAGTTGG - Intergenic
952862572 3:37826125-37826147 CATTATTAAGGAATAAGAGGAGG + Intergenic
953021621 3:39118050-39118072 GATTCTGAAGGAAGAAGAGGAGG - Exonic
954050819 3:47975621-47975643 CATTCTGAAGGAAACAGAAATGG + Intronic
955833581 3:63029794-63029816 CCTAATTAAGGAAGGAGAGTAGG - Intergenic
956008367 3:64804663-64804685 CATTATGAAGAAAACAAAGCTGG + Intergenic
956962239 3:74416501-74416523 ACATATGAAGGAAGCAGAGAGGG - Intronic
957431304 3:80111636-80111658 CATTTTGCAGGAAGCTCAGTAGG - Intergenic
957453391 3:80409764-80409786 CATTAGCAATGAAGCATAGTAGG + Intergenic
957566107 3:81886189-81886211 AATTAGTTAGGAAGCAGAGTTGG - Intergenic
959178072 3:102942816-102942838 ATTTATGAGGGAAGCAGACTAGG + Intergenic
959228324 3:103615331-103615353 CATTGTGAGGGAAGCAGAGAGGG - Intergenic
960528307 3:118735493-118735515 GATTGTAAAGGAAACAGAGTGGG - Intergenic
960617286 3:119607557-119607579 CACTATGGAGCAAGTAGAGTTGG + Intronic
964037116 3:152212984-152213006 CAGTATGAAGGATGAAAAGTGGG + Intergenic
967013052 3:185456899-185456921 TATTGTAAAGGAAGCAAAGTTGG - Intronic
967281547 3:187828497-187828519 CTTTAAGAAGGAAGCACAGAAGG + Intergenic
967533261 3:190573234-190573256 GATAATGAAGGAAGAAGAGATGG + Intronic
968277839 3:197454574-197454596 CGCTATGAAGCAGGCAGAGTAGG + Intergenic
974194909 4:58560719-58560741 TTTTAAGAAGGAAGCAGAGCTGG - Intergenic
975041167 4:69745622-69745644 AAGTTTGAAGGCAGCAGAGTTGG + Intronic
975098970 4:70490810-70490832 CACTATGAAGGAAGAAAACTGGG + Intergenic
975739189 4:77412151-77412173 TACTATGAAGGAAACAAAGTAGG - Intronic
980041071 4:127941304-127941326 AATGATGAAGTAAGCTGAGTTGG + Intronic
981489401 4:145323740-145323762 CTTTTTAGAGGAAGCAGAGTGGG + Intergenic
982460664 4:155666112-155666134 CACTATGAGGCAAGCACAGTAGG + Intergenic
982551089 4:156800641-156800663 TATTATGAATGAAGCAGGGTTGG + Intronic
985903106 5:2812685-2812707 CATGAAGAAGCAAGCAGAGTGGG - Intergenic
987784661 5:22484424-22484446 CATGATTAAAGAAGTAGAGTTGG - Intronic
989411788 5:41127747-41127769 TATGATGACAGAAGCAGAGTTGG + Intergenic
990447240 5:55904326-55904348 CAGTAAGAAGGAAGCTGAGTGGG + Intronic
990759777 5:59115624-59115646 CATAAGGAAGGAAGCAAAGGAGG - Intronic
991182152 5:63764976-63764998 AATAATGAGGGAAGCAGAATGGG - Intergenic
992902256 5:81309258-81309280 AATGATGAAGCAAGCACAGTTGG - Intronic
993106957 5:83610570-83610592 GATTCTAAAGGAAGCAGAGTTGG + Intergenic
993467415 5:88266119-88266141 TATTATGAATGAAGGAGAATAGG - Intronic
993748775 5:91639150-91639172 CCTTATGAAGGAAGAAGTGTAGG + Intergenic
994890595 5:105629516-105629538 CAGTTTAAAGGAAGCAGAGATGG + Intergenic
997698315 5:135878747-135878769 AATTATACAGGAATCAGAGTAGG + Intronic
998113031 5:139516719-139516741 CAATGTGAAGGAAGCAGAGGAGG + Intergenic
998335013 5:141364165-141364187 TAGTATGGAGGGAGCAGAGTCGG - Intronic
998669489 5:144337796-144337818 CATAGTGAAGGGAGAAGAGTGGG + Intronic
998735018 5:145127627-145127649 CAATATGGAGGAAGCTGAGATGG + Intergenic
998862715 5:146459787-146459809 TATCATGAAGGAAACGGAGTAGG + Intronic
999675315 5:153994988-153995010 CATTTTTAAGTGAGCAGAGTAGG + Intronic
999929442 5:156414703-156414725 CATTATAAACTATGCAGAGTGGG + Intronic
1000217085 5:159170163-159170185 CATTTTTCAGGAAGAAGAGTGGG - Intronic
1000864753 5:166499961-166499983 CATTTTGAAGGAAGCGGAGGAGG + Intergenic
1002875895 6:1208571-1208593 CATAATGAAGAAAGCAGGATTGG - Intergenic
1003174744 6:3746310-3746332 CAGGATGGGGGAAGCAGAGTGGG + Intronic
1003261037 6:4516429-4516451 CAGAAGGAAGGAAGGAGAGTTGG - Intergenic
1007934292 6:45719418-45719440 AGTCATGAAGGAAGCAGAGGAGG + Intergenic
1008241460 6:49117833-49117855 AATTATAAAGTAAGCAGAATTGG + Intergenic
1010111433 6:72238709-72238731 AACTATAAAGGAAACAGAGTTGG + Intronic
1010234120 6:73560878-73560900 AATTATTAAGGAAGGAGAGAGGG - Intergenic
1010910672 6:81551405-81551427 CCTTATGGAGGAAACAGAGAGGG - Intronic
1011237353 6:85232061-85232083 CAACATGGAGGAAGCAGGGTGGG - Intergenic
1011409687 6:87055089-87055111 CATTATGCAGGGAGGAGAATGGG - Intergenic
1011810337 6:91124870-91124892 TATTATGAAGAAAATAGAGTAGG - Intergenic
1011947368 6:92923029-92923051 CTTTATGAAGGAGCCAGAGAAGG - Intergenic
1012346467 6:98193518-98193540 CATCAGGAAAGAAGAAGAGTAGG - Intergenic
1014656613 6:124113628-124113650 CATTTCCAAGGAAGCAGGGTGGG - Intronic
1015702299 6:136049761-136049783 CATTAGGAGTGAAGAAGAGTGGG + Intronic
1016194675 6:141319563-141319585 CATCAAGAAGGAAGGAGAGAAGG + Intergenic
1017324183 6:153128336-153128358 CAGTGTTAAGTAAGCAGAGTTGG + Intronic
1019849207 7:3537827-3537849 CAGTGTTCAGGAAGCAGAGTTGG + Intronic
1020604021 7:10312473-10312495 TTTTATGGAGAAAGCAGAGTGGG + Intergenic
1021386805 7:20040891-20040913 CATTATGAAGAAAGAGGAGAAGG + Intergenic
1022902495 7:34824916-34824938 GATTAAGAAAGAAGCAGGGTGGG - Intronic
1023534805 7:41196965-41196987 GATTTTTAAGAAAGCAGAGTTGG + Intergenic
1024022990 7:45387876-45387898 CTGTATGTAGCAAGCAGAGTTGG - Intergenic
1032429460 7:131849154-131849176 GATAATGAAGGAAGCAGAAGGGG - Intergenic
1034530831 7:151695512-151695534 CATTGTGCAGGAAGCTGTGTTGG + Intronic
1036738136 8:11337821-11337843 CATCAAGAAGACAGCAGAGTAGG - Intergenic
1036771295 8:11579915-11579937 CATTATGAAGGACTCCGGGTGGG + Intergenic
1039110955 8:34040444-34040466 CAGTAGGAAGGTGGCAGAGTTGG - Intergenic
1040039772 8:42904270-42904292 CAGTATGAAGGAAGGAGTGGAGG - Intronic
1041304052 8:56441637-56441659 CATGAAGAAGGATGCAGAGGAGG - Exonic
1043766076 8:84133990-84134012 GCTTATGAAGGAAGCAGCGATGG + Intergenic
1045401206 8:101820112-101820134 CTTCAGGAATGAAGCAGAGTTGG + Intronic
1045436608 8:102170758-102170780 CATTAAGAAAGAAGCACATTTGG + Intergenic
1046325078 8:112631601-112631623 CCTTATGAAGTAAGCAGAGGAGG - Intronic
1046389416 8:113549463-113549485 CATAATGAAGGAAGGAGAGAAGG - Intergenic
1046914371 8:119664068-119664090 AATGATGACGGAGGCAGAGTAGG + Intronic
1047784566 8:128141500-128141522 CATTATGAAGGAAAGAGAACAGG - Intergenic
1048809539 8:138273530-138273552 CACTATGAAGAAAGCAGGCTTGG + Intronic
1048931961 8:139322356-139322378 CTTTTTGCAGGAAGCAGAATTGG - Intergenic
1049085316 8:140473963-140473985 CATTAGGAAAGGAGCAGACTAGG + Intergenic
1049809510 8:144558697-144558719 CTTTTTGCAGGGAGCAGAGTAGG - Intronic
1049940246 9:538678-538700 CATAAGGAAGGAGTCAGAGTTGG + Intronic
1052703882 9:31970857-31970879 CATGATGAAAATAGCAGAGTGGG + Intergenic
1052972154 9:34383209-34383231 GATTTTGAAGGAGGCAGAATAGG - Intronic
1056067470 9:82951856-82951878 CATTAAGAAGGAAACGTAGTAGG + Intergenic
1059054294 9:110962541-110962563 AATCTTGAAGGAAGAAGAGTAGG - Intronic
1061264227 9:129496329-129496351 CTTTCTGCAAGAAGCAGAGTGGG + Intergenic
1062213442 9:135376790-135376812 CAGTATGAAGGAGGGAGTGTGGG - Intergenic
1185777822 X:2819833-2819855 AATTCTGAAGGAAGCAGAAAAGG - Intergenic
1185882111 X:3750736-3750758 CATGAGGATGGAAGCAGAGGTGG + Intergenic
1187224914 X:17366701-17366723 AAGTATGAAGGAAGCAGAGGTGG + Intergenic
1187239476 X:17499618-17499640 GAGTATGAAGGAAGCTGAATGGG + Intronic
1188137314 X:26505230-26505252 CCTGATGGAAGAAGCAGAGTGGG - Intergenic
1188507064 X:30894042-30894064 GATTAGGTGGGAAGCAGAGTAGG - Intronic
1188874529 X:35413802-35413824 CATTGTGAATGGAGCAGATTTGG - Intergenic
1188920532 X:35971200-35971222 CAGAATGAGGGAAGCAGAATAGG + Intronic
1189556055 X:42146664-42146686 CATTATAAAGGGTACAGAGTGGG + Intergenic
1189612738 X:42754387-42754409 GATTGTGGAGGAAGCAGACTCGG + Intergenic
1191853338 X:65602428-65602450 AATTATGAAGGAAGCATGGGAGG - Intronic
1192226343 X:69230800-69230822 CAGTGTGAAGGCAGTAGAGTGGG - Intergenic
1194087430 X:89546191-89546213 AATAGTGAAGGAAGCAGGGTTGG - Intergenic
1195293677 X:103454425-103454447 CAGAATGAAGGAGGCAAAGTTGG - Intergenic
1195423568 X:104702502-104702524 CAGTCTGAAGCAATCAGAGTGGG - Intronic
1195455693 X:105066731-105066753 CATCATGAAGGAGGCAAATTAGG + Intronic
1195643177 X:107200039-107200061 CATTTTGAAGGAAACAGAGAGGG + Intronic
1196032498 X:111106187-111106209 CAGTATGAAAGTAGAAGAGTGGG - Intronic
1196993396 X:121353712-121353734 AAGTATGAAGGAAGCAAAGGGGG - Intergenic
1198708898 X:139479846-139479868 CAACATGAAGGAAGTAGAATAGG + Intergenic
1200440077 Y:3202063-3202085 AATAGTGAAGGAAGCAGGGTTGG - Intergenic
1200782863 Y:7232470-7232492 CATGAGGATGGAAGCAGAGGTGG - Intergenic