ID: 930127018

View in Genome Browser
Species Human (GRCh38)
Location 2:47808194-47808216
Sequence TCTAATCCTTGTACATTAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930127018 Original CRISPR TCTAATCCTTGTACATTAGC TGG (reversed) Exonic
901009521 1:6191739-6191761 TATAATCCTTGTACTTTGGGAGG + Intronic
902387889 1:16086210-16086232 TCTAATCCCAGTACATTGGGAGG - Intergenic
903706075 1:25286835-25286857 TGTAATCCTAGTACTTTAGGAGG + Intronic
903721166 1:25406567-25406589 TGTAATCCTAGTACTTTAGGAGG - Intronic
903872648 1:26447730-26447752 TGTAATCCTAGCACATTAGGAGG + Intronic
904060458 1:27705900-27705922 TCTAATCCTAGCACTTTAGGAGG - Intergenic
904185974 1:28705130-28705152 TGTAATCCCAGTACATTAGGAGG + Intronic
904646217 1:31968704-31968726 TCTAATCCTAGCACTTTAGGAGG - Intergenic
907070820 1:51533223-51533245 TGTAATCCTTGTACTTTGGAAGG + Intergenic
907178182 1:52545117-52545139 TATAATCCTTGTACTTTGGGAGG + Intronic
908362943 1:63387796-63387818 TCTAATCCCAGTACTTTGGCAGG - Intronic
908891415 1:68852802-68852824 TCAAATCCTTTTACAATAGCTGG - Intergenic
910563052 1:88613143-88613165 TCTAATCCTAGCACTTTAGGAGG + Intergenic
911029768 1:93473986-93474008 TCTAATCCTAGTACTTTGGGAGG + Intronic
911300641 1:96168957-96168979 TCTAATACTTTTAGATTACCAGG + Intergenic
911652230 1:100402693-100402715 TCTAGTCCTTCTCCATTAGCTGG - Intronic
915137127 1:153740354-153740376 TCTAATCCTAGCACTTTAGGAGG - Intronic
917362242 1:174189710-174189732 TGTAATCCTTGTACTTTGGGAGG + Intronic
918054727 1:181010556-181010578 TGTAATCCTAGCACATTAGGAGG - Intronic
919597355 1:199580625-199580647 TGTAATCCTAGTACATTGGGAGG + Intergenic
920244686 1:204578759-204578781 TCAAATCCGTGTACATTTGCTGG + Intergenic
920774835 1:208925741-208925763 TCTAATCCCAGTACTTTGGCAGG - Intergenic
920937057 1:210445272-210445294 GCAAATCCTTGTAGATTATCTGG - Intronic
921504116 1:215945629-215945651 TTTAATCCTTGTTCATTTGTGGG + Intronic
921563936 1:216693386-216693408 TCTAATCCTTGCACTTTGGGAGG - Intronic
922861868 1:228825914-228825936 TCTAAACCTCCTACATTACCTGG + Intergenic
923751060 1:236746449-236746471 TGTAATCCTTGTACTTTGGGAGG + Intronic
923889404 1:238195572-238195594 TCTAATTCTTGTAGAATACCAGG - Intergenic
923993418 1:239465186-239465208 TGGAAACCTTGTACATCAGCTGG - Intronic
924194646 1:241593029-241593051 TCTAATCCCTGTACTTTGGGAGG - Exonic
924718186 1:246598239-246598261 TCTAATCCTAGCACTTTAGGGGG - Intronic
1063708354 10:8452873-8452895 TATAATCCTAGTACTTTAGGAGG - Intergenic
1064202362 10:13295677-13295699 TCTAATACTAGCACTTTAGCGGG + Intronic
1065196139 10:23266999-23267021 TATAATCCTAGTACTTTAGGAGG - Intergenic
1066184196 10:32993110-32993132 TCTAATCCCAGTACATTGGGAGG + Intronic
1066545402 10:36494561-36494583 TCTCATCTTTGTCCATTAGTAGG - Intergenic
1069350024 10:67514052-67514074 TCTAATCCTTGCACTTTGGGAGG + Intronic
1070181645 10:74019804-74019826 TCTAATCCCTGCACTTTAGGAGG + Intronic
1071682504 10:87720140-87720162 TCTAATCCTAGCACTTTAGGAGG - Intronic
1071712788 10:88066187-88066209 TTTAATCCCTGCACATTGGCAGG + Intergenic
1072974159 10:100043137-100043159 TGTAATCCTTGCACTTTAGGAGG + Intronic
1074488856 10:113919820-113919842 TGTAATCCTAGTACTTTAGGTGG + Intergenic
1075428172 10:122358152-122358174 TTTAACCCTTGTATTTTAGCAGG - Intergenic
1075768390 10:124913168-124913190 TCTAATCCTAGTACTTTGGGAGG - Intergenic
1078283047 11:9921987-9922009 TGTAATCCTAGTACTTTAGGAGG + Intronic
1078316483 11:10297314-10297336 TCTAATCCTAGTACCTTGGGAGG - Intergenic
1078664365 11:13312364-13312386 TCTAGTCCTTCTACATTAGTAGG - Intronic
1079035827 11:17019004-17019026 TGTAATCCTAGTACTTTGGCAGG - Intergenic
1080632344 11:34089508-34089530 TATAATCCTAGTACTTTAGGAGG + Intronic
1081102040 11:39014466-39014488 TGTAATCCTAGTACTTTAGGAGG + Intergenic
1082262957 11:50091286-50091308 TCTAATCCTTGCACTTTGGGAGG + Intergenic
1085653278 11:78288121-78288143 TGTAATCCTAGTACTTTAGGAGG + Intronic
1087652286 11:100881867-100881889 TCAACTCCTTTTACAATAGCTGG - Intronic
1088209483 11:107438786-107438808 TGTAATCCTTGCACTTTGGCAGG + Intronic
1088263226 11:107964757-107964779 TCAAATACTTGTACATTTTCTGG + Intergenic
1092067343 12:5602508-5602530 TGTAATCCTTGTACTTTGGGAGG - Intronic
1094223918 12:28025007-28025029 TCTAATCCTGGTACTTTGGGAGG - Intergenic
1094584442 12:31764823-31764845 TGTAATCCTTGCACTTTAGGAGG - Intergenic
1096362208 12:50997729-50997751 TGTAATCCTAGCACTTTAGCAGG + Intronic
1096427565 12:51517041-51517063 TCTAATACTTGTACAAAATCAGG + Intergenic
1097026741 12:56062013-56062035 TATAATCCTAGTACATTGGGAGG - Intergenic
1097091595 12:56509798-56509820 TCTAATCCTAGCACTTTAGGAGG - Intergenic
1097584316 12:61497094-61497116 TCTAATCCTTGAAAAGTAGAGGG + Intergenic
1097593214 12:61596995-61597017 TCTCTTCCTTGTGCAGTAGCTGG + Intergenic
1099791731 12:87343808-87343830 TCTCATCCTTTTACATTTTCAGG - Intergenic
1102081995 12:110105790-110105812 TGTAATCCTTGTACTTTGGGAGG - Intergenic
1103662813 12:122535382-122535404 TGTAATCCTTGTACTTTGGAAGG + Intronic
1103756140 12:123208839-123208861 TGTAATCCTTGTACTTTGGGAGG - Intronic
1103799322 12:123527072-123527094 TATAATCCTTGTAATTTAGGAGG + Intronic
1104060966 12:125267987-125268009 TGTAATCCCTGTACTTTAGGAGG + Intronic
1105212651 13:18266460-18266482 TCTAATCCTAGCACTTTAGGAGG - Intergenic
1106824478 13:33504797-33504819 TATAATCCCTGCACATTGGCAGG - Intergenic
1107049017 13:36027681-36027703 TCTTTACCTAGTACATTAGCTGG + Intronic
1107364058 13:39651207-39651229 TCTAATCCTAGTACTTTTGGAGG - Intergenic
1107849444 13:44556288-44556310 TGTAATCCTTGTACTTTGGGAGG + Intronic
1115350294 14:32387047-32387069 TCAACTCCTTTTACAATAGCTGG - Intronic
1115451196 14:33549488-33549510 TGTAATCCTAGCACATTAGAAGG - Intronic
1117686833 14:58262183-58262205 TGTAATCCTTGCACTTTGGCAGG - Intronic
1117774724 14:59171299-59171321 TCTAATCCCAGTACTTTAGGAGG - Intergenic
1121143799 14:91566016-91566038 TGTAATCCTAGCACATTAGGAGG - Intergenic
1130556101 15:84923608-84923630 TCACATCCTTTTACATGAGCAGG + Intronic
1130794652 15:87195579-87195601 TATAATCCTAGTACTTTAGGAGG + Intergenic
1131167587 15:90153578-90153600 TGTAATCCCTGTGGATTAGCAGG - Intergenic
1133322114 16:4920857-4920879 TGTAATCCCTGTACTTTAGGAGG - Intronic
1134101577 16:11456302-11456324 TGTAATCCTAGTACTTTAGGAGG - Intronic
1134571934 16:15298497-15298519 TCTATTCATTGTAAATTACCTGG + Intergenic
1134600690 16:15531348-15531370 TCTAATCCTAGGACTTTAGGAGG - Intronic
1134730448 16:16457546-16457568 TCTATTCATTGTAAATTACCTGG - Intergenic
1134936983 16:18254350-18254372 TCTATTCATTGTAAATTACCTGG + Intergenic
1136931397 16:34421108-34421130 TGTAATCCTAGCACTTTAGCAGG + Intergenic
1136973176 16:34990711-34990733 TGTAATCCTAGCACTTTAGCAGG - Intergenic
1137012933 16:35341810-35341832 TCAATTCCTTTTACAATAGCTGG + Intergenic
1139242582 16:65409164-65409186 CCTAAACCTAGTACATTGGCTGG - Intergenic
1139629689 16:68222031-68222053 TGTAATCCTAGTACTTTAGGAGG + Intronic
1139803670 16:69545339-69545361 TGTAATCCTTGTACTTTGGGAGG - Intergenic
1140387943 16:74559125-74559147 TGTAATCCCTGTACTTTAGGAGG - Intronic
1141667161 16:85471659-85471681 TGTAATCCTTGTACTTTGGTAGG - Intergenic
1143629786 17:8132033-8132055 TGTAATCCTAGTACTTTAGGAGG - Intergenic
1144326132 17:14182032-14182054 TCTCATCCTTCTAGATTAACAGG + Intronic
1146140667 17:30365243-30365265 TCTAATCCTAGCACTTTAGGAGG + Intergenic
1147289966 17:39433813-39433835 TCTAATCCCAGTACATTGGGAGG - Intronic
1147878382 17:43637881-43637903 TCTGATTCTTCTACTTTAGCTGG - Intergenic
1148006764 17:44438513-44438535 TCTGATCCTTGTTCATTAAAGGG - Intronic
1148008306 17:44453086-44453108 TGTAATCCTTGCACTTTGGCAGG - Intronic
1148468648 17:47879717-47879739 TCTAATCCTGGCACTTTAGGAGG - Intergenic
1149539701 17:57459735-57459757 TCTAATCCTAGCACTTTAGGAGG + Intronic
1149588983 17:57813616-57813638 TATAATCCTTGCACTTTAGGAGG + Intergenic
1149609591 17:57950407-57950429 TGTAATCCTAGCACTTTAGCAGG - Intronic
1149707829 17:58711726-58711748 TGTAATCCTAGTACTTTAGGAGG - Intronic
1153001712 18:461642-461664 TGTAATCCTAGTACTTTAGTAGG - Intronic
1153808462 18:8731315-8731337 TCTAATCCCAGTACTTTAGGAGG + Intronic
1158019473 18:52824559-52824581 TCTAATGCTTGTACATTGAGAGG + Intronic
1158167879 18:54561705-54561727 TCTGATGCTTGTACAATAACTGG - Intergenic
1161709620 19:5840722-5840744 TCTAATCCCAGTACTTTAGGAGG - Intergenic
1163522974 19:17802944-17802966 TATAATCCTTGCACTTTAGGAGG - Intronic
1163564563 19:18042920-18042942 TCTAATCCCAGTACTTTAGGAGG + Intergenic
1168033388 19:53699485-53699507 TCTAATCCCAGCACATTAGGAGG - Intergenic
1168035493 19:53716073-53716095 TCTAATCCTAGCACATTAGGGGG - Intergenic
1168232151 19:55039583-55039605 TGTAATCCTAGTACTTTAGGAGG + Intronic
1168596178 19:57679509-57679531 TCTCATCCTTGTTCCTCAGCAGG - Intergenic
925935791 2:8758117-8758139 TGTAATCCCAGTACTTTAGCAGG - Intronic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
928019842 2:27695550-27695572 TGTAATCCTAGTACTTTAGGAGG - Intergenic
929677758 2:43954449-43954471 TCTAATACTTGTAAGTTTGCAGG + Intronic
929844396 2:45507459-45507481 TGTAATCCTTGTACTTTGGGAGG + Intronic
930127018 2:47808194-47808216 TCTAATCCTTGTACATTAGCTGG - Exonic
931330358 2:61275018-61275040 TGTAATCCTGGCACATTAGGAGG + Intronic
932498868 2:72162698-72162720 TGTAATCCTAGCACCTTAGCAGG + Intergenic
933736461 2:85499212-85499234 TCTAATCCCTGCACTTTGGCAGG - Intergenic
933739098 2:85518983-85519005 TCTAATCCCAGTACTTTAGGAGG - Intergenic
942300488 2:174556713-174556735 TGTAATCCTTGCACATTAGGAGG + Intergenic
942569575 2:177300146-177300168 TGTAATCCTAGTACCTTAGGAGG - Intronic
942639238 2:178043336-178043358 TCAAATCTGTGTACCTTAGCAGG - Intronic
942689191 2:178567278-178567300 TCTAATACTTTTACATTTACTGG + Exonic
942913809 2:181278185-181278207 TATAATCCTTGCACTTTAGGTGG + Intergenic
944789476 2:203109774-203109796 TGTAATCCTAGCACTTTAGCAGG - Intronic
945890797 2:215428760-215428782 TGTAATCCTAGTACTTTAGGAGG + Intronic
946038982 2:216767530-216767552 TCTAATCACTCTACCTTAGCAGG + Intergenic
947755455 2:232560517-232560539 TGTAATCCTTGTACTTTGGGAGG + Intronic
1172239600 20:33403714-33403736 TCTAATCCTAGCACTTTAGGAGG - Intergenic
1173284611 20:41658988-41659010 TGTAATCCTAGTTCTTTAGCAGG - Intergenic
1180815465 22:18786785-18786807 TCTAATCCTAGCACTTTAGGAGG - Intergenic
1181201655 22:21221120-21221142 TCTAATCCTAGCACTTTAGGAGG - Intronic
1181700097 22:24615851-24615873 TCTAATCCTAGCACTTTAGGAGG + Intronic
1182326874 22:29519888-29519910 TATAATCCTTGTACTTTGGGAGG - Intronic
1182679211 22:32065201-32065223 TCTAATCCCAGTACTTTAGGAGG - Intronic
1183920939 22:41167738-41167760 CCTAATCCTTGTACTTTGGGAGG - Intronic
1184266936 22:43352886-43352908 TCTAATCCTAGTACTTTGGGAGG + Intergenic
1184267211 22:43355101-43355123 TGTAATCCTAGCACTTTAGCAGG + Intergenic
1203225259 22_KI270731v1_random:74308-74330 TCTAATCCTAGCACTTTAGGAGG + Intergenic
1203265568 22_KI270734v1_random:12476-12498 TCTAATCCTAGCACTTTAGGAGG - Intergenic
950311385 3:11961443-11961465 TCTAATCCTAGCACTTTAGGAGG + Intergenic
951623197 3:24629406-24629428 TCTAATCTTAGTACTTTAGGAGG + Intergenic
952305585 3:32143345-32143367 TGTAATCCCGGTACATCAGCAGG - Intronic
953486421 3:43301507-43301529 TGTAATCCTTGTACTTTGGGAGG + Intronic
954115002 3:48461960-48461982 TGTAATCCTTGCACTTTGGCAGG - Intronic
955697275 3:61649274-61649296 TGTAATCCTAGTACTTTAGCAGG - Intronic
955821302 3:62898886-62898908 TGTAATCCTTGTACTTTGGAAGG + Intergenic
956753421 3:72363069-72363091 TCTTTTCCTTATACATTACCCGG + Intergenic
957697257 3:83655915-83655937 TCTAATGCTAGCACATTAGATGG + Intergenic
962546780 3:136444328-136444350 TGTAATCCTAGTACTTTGGCAGG - Intronic
962593218 3:136912912-136912934 TGTAATCCTTGTATTTTAGGAGG - Intronic
963426772 3:145139176-145139198 TGTAATCCTAGTACTTTAGGAGG - Intergenic
965048943 3:163618843-163618865 TCTAATCCTAGCACTTTAGGAGG - Intergenic
965789982 3:172377011-172377033 CCTAATCCCTGTGCGTTAGCTGG - Intronic
966215978 3:177502797-177502819 TCTAATCCCAGCACATTAGGAGG - Intergenic
966524737 3:180908377-180908399 TCTAATCCCAGGACATTAGGAGG + Intronic
966543429 3:181117291-181117313 TCTAATACGTGTCCATTAGAAGG + Intergenic
967931531 3:194693877-194693899 TGTAATCCTAGTACTTTAGGAGG - Intergenic
968407866 4:357208-357230 TGTAATCCTAGTACATTGGGAGG - Intronic
970621838 4:17830136-17830158 TGTAATCCTAGTACATTGGGAGG + Intronic
971625331 4:28912696-28912718 TATAATTCTTGCATATTAGCAGG + Intergenic
971806119 4:31359055-31359077 TCTGATCTTTGTAAATTACCCGG + Intergenic
972438375 4:39058367-39058389 TGTAATCCTTGGACTTTAGGGGG + Intronic
974717850 4:65693917-65693939 TCTAATCCCAGTACTTTAGGAGG - Intergenic
975167888 4:71198702-71198724 TGTAATCCTTGTGCTTTAGGAGG + Intronic
976231393 4:82846969-82846991 TGTAATCCCTGTACGTTAGGAGG - Intronic
976907710 4:90260970-90260992 TCTAATCCTAGTACTTTGGGAGG - Intronic
979315526 4:119257183-119257205 TGTAATCCTAGTACATTGGGAGG + Intronic
980462328 4:133131596-133131618 TCTATTACTTGTGCATTATCAGG + Intergenic
982359564 4:154505061-154505083 TGTAATCCTTGTACTTTGGGAGG - Intergenic
982746630 4:159110329-159110351 TCTAATCCTAGCACTTTAGGAGG + Intronic
983356150 4:166660083-166660105 TCTAATCCTAGTACTTTAGGAGG - Intergenic
984252971 4:177356472-177356494 TTTATTCCTTGTAAAGTAGCTGG - Intronic
986674119 5:10168575-10168597 TGTAATCCTAGTACAGGAGCCGG + Intergenic
988123077 5:26992838-26992860 TGTAATCCTAGCACATTAGAAGG + Intronic
988519420 5:31932290-31932312 TGTAATCCTTGTACTTTAGGAGG + Intronic
990725051 5:58744127-58744149 TCTTGTCCTTGTACATGACCAGG - Intronic
990866469 5:60385873-60385895 TCAATTCCTTGTACCCTAGCTGG + Intronic
991716611 5:69456825-69456847 TCTAATCCTTGCACTTTGGGAGG + Intergenic
991731024 5:69588427-69588449 TCTAATCCTTGCACTTTGGGAGG + Intronic
991807457 5:70443586-70443608 TCTAATCCTTGCACTTTGGGAGG + Intergenic
991863926 5:71039425-71039447 TCTAATCCTTGCACTTTGGGAGG - Intronic
992200749 5:74381428-74381450 TCTAATCCTAGCACTTTAGGAGG + Intergenic
992699165 5:79323206-79323228 TATAATCCTAGCACTTTAGCAGG - Exonic
992768122 5:80021771-80021793 TGTAATCCTTGTACTTTAGGAGG - Intronic
992832535 5:80608320-80608342 TGTAATCCTTGTACTTTGGGAGG + Intergenic
996885631 5:128350676-128350698 TTTTATCCTGGTACATAAGCAGG - Intronic
998227337 5:140337085-140337107 TGTAATCCTTGCACATTGGGAGG - Intronic
1001576026 5:172764300-172764322 TGTAATCCTAGTACTTTAGGAGG + Intergenic
1004605020 6:17185889-17185911 TCTAATCTTTGTTCTTTATCTGG - Intergenic
1005612339 6:27538478-27538500 TCTCAGCCTTGTAAATTAGGAGG + Intergenic
1005907693 6:30278967-30278989 TCTAATCCTAGCACTTTAGGAGG - Intergenic
1006643513 6:35500639-35500661 TCTAATCCATGAACGTGAGCAGG - Intronic
1007717659 6:43866538-43866560 TCTCATCCTTGAACTTGAGCTGG - Intergenic
1008803231 6:55395894-55395916 TAAAATCCTTGTACATTTGATGG - Intronic
1009588346 6:65635568-65635590 TGTAATCCTTGTACTTTGGGAGG - Intronic
1009735936 6:67675589-67675611 TCTCATCCTTGGACATTTCCTGG - Intergenic
1011283577 6:85701290-85701312 TGTAATCCTTGTACTTTGGGAGG - Intergenic
1012524744 6:100163984-100164006 TGTAATCCAGTTACATTAGCTGG - Intergenic
1014325707 6:119989970-119989992 AATAATCCTTTTACATTAACAGG + Intergenic
1015372435 6:132469579-132469601 TATAATCCTAGTACTTTAGGAGG + Intronic
1015603598 6:134933963-134933985 TGTAATCCTAGTACTTTGGCAGG - Intronic
1016365603 6:143314090-143314112 TATAATCCTTGCACTTTAGAAGG + Intronic
1016475759 6:144425541-144425563 ATTAATCCTTCTACATTAGTTGG + Intronic
1016481508 6:144486774-144486796 TCTAATCCTAGCACATTGGGAGG - Intronic
1017015880 6:150099135-150099157 TCTAATCTTTGTACGTTTTCTGG + Intergenic
1019333774 7:473128-473150 TGTAATCCTTGCACTTTAGGAGG - Intergenic
1023116810 7:36870626-36870648 TCTAATCCTGGGACACTACCTGG - Intronic
1023145150 7:37143661-37143683 TGTAATCCTAGCACATTAGGAGG - Intronic
1023903233 7:44501387-44501409 TGTAATCCTGGTACATTGGGAGG - Intergenic
1024939024 7:54742993-54743015 TCTAATCCTAGCACTTTAGGAGG - Intergenic
1025700162 7:63811303-63811325 TGTAATCCTAGCACTTTAGCAGG - Intergenic
1026730440 7:72906883-72906905 TGTAATCCCAGTACATTAGGGGG - Intronic
1026748723 7:73032934-73032956 TCTAATCCTAGTACTTTGGGAGG - Intergenic
1026752371 7:73061079-73061101 TCTAATCCTAGTACTTTGGGAGG - Intergenic
1026756022 7:73089206-73089228 TCTAATCCTAGTACTTTGGGAGG - Intergenic
1027034919 7:74918200-74918222 TCTAATCCTAGTACTTTGGGAGG - Intergenic
1027091383 7:75304223-75304245 TCTAATCCTAGTACTTTGGGAGG + Intergenic
1027095027 7:75332194-75332216 TCTAATCCTAGTACTTTGGGAGG + Intergenic
1027324312 7:77035480-77035502 TCTAATCCTAGTACTTTGGGAGG - Intergenic
1028310942 7:89334954-89334976 TCCAGTCCTTGTACAGTAGGGGG + Exonic
1029141100 7:98410922-98410944 TCTAATCCCAGTACATTGGGAGG - Intergenic
1029395136 7:100302930-100302952 TCTAATCCTAGTACTTTGGGAGG + Intergenic
1029889239 7:103908860-103908882 TCTGCTCTTTGTACATTGGCTGG + Intronic
1031244566 7:119292820-119292842 TGTAATCCCAGTACATTGGCAGG + Intergenic
1033391348 7:140931097-140931119 TATAATCCTAGCACATTAGGAGG - Intergenic
1033404568 7:141060244-141060266 TGTAATCCTAGTACATTGGGAGG + Intergenic
1036007765 8:4686553-4686575 TCTAATGCTTATAAATCAGCAGG - Intronic
1037002855 8:13741786-13741808 TAAAATCCATCTACATTAGCTGG + Intergenic
1037155977 8:15699102-15699124 TGTAATCCTGGTACTTTGGCAGG - Intronic
1037627565 8:20621307-20621329 GCTAATCCTTGAGGATTAGCTGG + Intergenic
1037772009 8:21807422-21807444 TCTATTCTTTGTAAATTACCCGG + Intronic
1038197561 8:25382231-25382253 TATAATCCTTGCACATTGGGAGG - Intronic
1039497366 8:37990938-37990960 TGTAATCCTAGCACTTTAGCAGG - Intergenic
1039501799 8:38023612-38023634 TCTAATCCTAGTACTTTGGGAGG - Intergenic
1039814331 8:41079548-41079570 TCGAATCCTTTTAAATTATCAGG + Intergenic
1043460174 8:80451845-80451867 TCTAATCCTAGCACATTGGGAGG - Intergenic
1046965596 8:120161919-120161941 TGTAATCCTTGCACTTTAGGAGG - Intronic
1047463088 8:125087470-125087492 TGTAATCCTAGTACTTTAGAAGG + Intronic
1047917748 8:129600936-129600958 TGTAATCCTAGTACATTGGGAGG - Intergenic
1048485688 8:134845248-134845270 TTTATTCCTTGTAAATTACCCGG + Intergenic
1050473608 9:6018514-6018536 TGTAATCCTAGTACTTTAGGAGG - Intergenic
1050550453 9:6744649-6744671 TGTAATCCTAGTACATTGGGAGG - Intronic
1051510492 9:17872451-17872473 TGTAATCCCAGTACATTAGGAGG - Intergenic
1051659712 9:19414524-19414546 TCTAATCCTAGTACTTTAGGAGG + Intronic
1052423753 9:28276975-28276997 ACTAAGCCTTGAACATTAGAGGG - Intronic
1055741339 9:79392944-79392966 TGTAATCCTTGCACTTTAGGAGG + Intergenic
1056367622 9:85921334-85921356 TGTAATCCTAGCACATTGGCAGG - Intergenic
1058499311 9:105594227-105594249 TATAATTCTTGTACAGTAGGTGG + Intronic
1060345651 9:122813402-122813424 TGTAATCCCTGTACTTTAGGAGG + Intronic
1062515790 9:136934809-136934831 TCTATTCCTTATAAATTATCTGG + Intronic
1062561218 9:137142911-137142933 TCCAATCCTGGAACATCAGCTGG + Intronic
1186091671 X:6055236-6055258 TCTAATCCTGGCACATTGGAAGG + Intronic
1187455714 X:19439723-19439745 TGTAATCCTAGTACTTTGGCAGG - Intronic
1188187726 X:27135652-27135674 TCTACTCCTTGATCATTTGCAGG - Intergenic
1188460516 X:30421606-30421628 TCTAATCCTAGCACATTGGGAGG - Intergenic
1189508154 X:41634016-41634038 TGTAATCCTAGTACATTTGGAGG - Intronic
1190189774 X:48267814-48267836 TGTAATCCTAGTACTTTAGGAGG - Intronic
1190847299 X:54206140-54206162 TGTAATCCTAGTACTTTAGGAGG + Intronic
1191083105 X:56534895-56534917 TCTAATCCTAGTGCATTGGGAGG + Intergenic
1193157296 X:78187849-78187871 TCTACTTCTTTTACAATAGCTGG + Intergenic
1193984448 X:88222881-88222903 GCTAATCCTGGTTCATTACCCGG - Intergenic
1194492261 X:94566619-94566641 TGTAATCCCAGCACATTAGCAGG - Intergenic
1195041859 X:101021840-101021862 TCTGGTCCTTGTACACCAGCTGG - Intronic
1195053431 X:101119896-101119918 TGTAATCCTAGTACTTTAGGAGG + Intronic
1201291918 Y:12428322-12428344 GCTATTCCTTGTACGTTAGTAGG - Intergenic
1201646565 Y:16239362-16239384 TCTAATCCCGATACATTAGGAGG - Intergenic
1201656248 Y:16345955-16345977 TCTAATCCCGATACATTAGGAGG + Intergenic