ID: 930127365

View in Genome Browser
Species Human (GRCh38)
Location 2:47812126-47812148
Sequence TTGAGGCTACAGAAGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930127365 Original CRISPR TTGAGGCTACAGAAGGGGCA AGG (reversed) Intronic
902041390 1:13495082-13495104 CTGAGACCACAGAAGGGTCAGGG + Intronic
902122496 1:14178939-14178961 TAGAGACTCCAGAAGGGCCAGGG - Intergenic
902233862 1:15045207-15045229 TTGTGGCTAGAGTAGGGGAAGGG + Intronic
902409288 1:16203431-16203453 TAGATGCTCCAGAAGTGGCAGGG - Intronic
902409859 1:16206438-16206460 GTGGGGCTAGAGAAGGGGCGAGG - Intronic
902659785 1:17893040-17893062 CAGAGGCTGCAGAAGGGGAACGG - Intergenic
902852321 1:19169534-19169556 TGGAGGCGACAGAAAGGACAAGG + Intronic
903009331 1:20319032-20319054 TTGAGGCTACAGAATTTCCAGGG - Intronic
903333798 1:22611851-22611873 TTCAGGCTACAAGAGAGGCAAGG - Intergenic
903675609 1:25062818-25062840 CTGAGTCTCCAGCAGGGGCAGGG - Intergenic
904459003 1:30664377-30664399 TTCAGACTGCAGAATGGGCAGGG - Intergenic
905412396 1:37779579-37779601 TGGAGGACACAGAAGGGACAGGG + Intergenic
906226688 1:44128621-44128643 TTGAGGCTGCAGATGGGTCTCGG - Intronic
906462187 1:46043277-46043299 TTGAGAGTGCAGCAGGGGCATGG - Exonic
908028775 1:59977865-59977887 CTGAGGCTAAAGAAGGGGGAAGG - Intergenic
908467142 1:64407772-64407794 TGGAGGCTTCAGAGGGAGCATGG - Intergenic
910709220 1:90161652-90161674 TTGAGGATCCAAAAAGGGCAGGG - Intergenic
911431942 1:97800797-97800819 TTGACTCTACAGAAGGTGGAAGG - Intronic
912761705 1:112373297-112373319 TGGAGACTACAGAAGGTGGAAGG + Intergenic
912788335 1:112625909-112625931 TTGAGGCCAGAGATGTGGCAAGG - Intronic
912959378 1:114181546-114181568 CTGAGCCTACAGATGGGGGAGGG + Intergenic
913187582 1:116383231-116383253 TTCAGGCTACAGAATGGGCTGGG + Intronic
914446714 1:147756971-147756993 TGGAGGCTTTAGCAGGGGCAAGG - Exonic
915503199 1:156334496-156334518 TAGAGACTTCAGAAGGAGCATGG + Intronic
915601554 1:156925689-156925711 GGGAGCCTAGAGAAGGGGCAGGG - Intronic
916445245 1:164865962-164865984 CTGAGGCTACAGAAAGTGCAGGG - Intronic
916739271 1:167634025-167634047 TTGAGTCTCCAGAATGAGCACGG + Intronic
918276301 1:182956317-182956339 ATGAGTCTACAGAAAGGCCATGG + Intergenic
918582422 1:186146737-186146759 TTGAGGCTCCAGCTGAGGCATGG + Intronic
918756042 1:188340290-188340312 TTGAGGCAACAGTAATGGCATGG - Intergenic
919497132 1:198286922-198286944 GAGATGCAACAGAAGGGGCAGGG - Intronic
922919095 1:229285586-229285608 TTGAGGCCACAGAAGGAGTCAGG + Intronic
1062971998 10:1655091-1655113 GTGAGGTTCCAGCAGGGGCAGGG + Intronic
1063668690 10:8082361-8082383 TAGAGGTTACAGCAGGGGAAGGG + Intergenic
1066386940 10:34949058-34949080 TGGAGGCAACAGAAGGGCCTGGG - Intergenic
1067451914 10:46386975-46386997 TTAGGGCTGCAGAAGGAGCATGG - Intronic
1067465091 10:46491750-46491772 TTGTGGCCACAGAAGGGTGAGGG + Intergenic
1067585324 10:47472780-47472802 TTAGGGCTGCAGAAGGAGCATGG + Intronic
1067622097 10:47892851-47892873 TTGTGGCCACAGAAGGGTGAGGG - Intergenic
1067661192 10:48237384-48237406 TGGAGGCCAGAGAAGGGCCAAGG + Intronic
1068306051 10:55209703-55209725 TTGAGAGTTGAGAAGGGGCATGG + Intronic
1069625558 10:69865736-69865758 TTGAGTCTAGAGAAGGGGGCTGG + Intronic
1069641154 10:69956287-69956309 TTGAGGCTAAAGGAGCTGCATGG + Intronic
1069968709 10:72145936-72145958 ATGAGGCTGCAGAACAGGCAGGG - Intronic
1073065542 10:100756895-100756917 TTGAGTCCAGAGAAGGGGAAAGG + Intronic
1073291370 10:102414862-102414884 TTGAGGCCTCTGAAGGGGCCCGG - Exonic
1076820548 10:132936713-132936735 GTGAGGCCACAGAAGGGAGAGGG - Intronic
1080691330 11:34561080-34561102 TTGAGTCTAGAGAATGAGCAGGG - Intergenic
1081179958 11:39972920-39972942 GTGAGGCAAGAGAATGGGCATGG - Intergenic
1081322497 11:41708244-41708266 TGGAGGCTTCAGAGGGAGCATGG + Intergenic
1083016265 11:59457453-59457475 TTGGGGCCACAGAAGGGGAATGG - Exonic
1083709474 11:64539232-64539254 CTGAGGCGACAGGAGGAGCAGGG + Intergenic
1084414049 11:69020504-69020526 TTGAAGTTACAGAATGTGCAAGG - Intergenic
1084533000 11:69740278-69740300 TGGAGCCTTCAGAAGGAGCAGGG - Intergenic
1085038181 11:73311857-73311879 TTGGGGCCAAAGAAGGGCCATGG + Intronic
1085083061 11:73649338-73649360 TTGACGCTACTGCAGGAGCAGGG - Intronic
1085464893 11:76716644-76716666 TGGAGGCAAGAGAAGGGGCAGGG + Intergenic
1087194960 11:95296184-95296206 TTGTGCCTAGAGAAGAGGCATGG + Intergenic
1087307232 11:96501548-96501570 TTGATACCACAGATGGGGCAAGG - Intronic
1088102184 11:106167746-106167768 TTGAGGCTACAGAAAGAACAGGG + Intergenic
1090375634 11:126286863-126286885 TGGAGCCTTCAGAAGGAGCACGG - Intronic
1091186403 11:133651543-133651565 TGGAGGCTATAGAGGGGGCAGGG - Intergenic
1091664794 12:2411463-2411485 TTTAGCCCACAGAAGGAGCAGGG - Intronic
1092556825 12:9568942-9568964 ATGAGGTCACAAAAGGGGCAGGG - Intergenic
1092994766 12:13939437-13939459 ATGTGGCAACAGAAGGAGCAAGG - Intronic
1093511614 12:19936027-19936049 TTGAGACTACAGAAGGAGTGGGG + Intergenic
1093677678 12:21962904-21962926 GTCAGGCTACACAAGGGTCAAGG - Intergenic
1094616840 12:32043563-32043585 TGGAGCCTTCAGAAGGAGCATGG - Intergenic
1095528756 12:43159667-43159689 CTGAGGCTAAACAACGGGCAAGG - Intergenic
1096176390 12:49523142-49523164 ATGAGGTTACTGTAGGGGCAGGG - Intronic
1096868756 12:54580182-54580204 TGGGGGCTACAGAGAGGGCAGGG + Exonic
1098498351 12:71163012-71163034 ATGTGGCCACAGAGGGGGCAGGG - Intronic
1099278085 12:80603813-80603835 GTGATGATACAGATGGGGCAGGG - Intronic
1102897381 12:116609554-116609576 CTGAGGCTTCAGAACAGGCAGGG + Intergenic
1103741823 12:123096309-123096331 ATGAGGCCACAGAAGAGGAATGG + Intronic
1105495112 13:20923674-20923696 TTAAGGCTACAGAAAGAACATGG - Intergenic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1106298430 13:28439809-28439831 TGCAGGTTTCAGAAGGGGCATGG + Intronic
1106470536 13:30050313-30050335 TGGAGCCTACAGAGGGAGCATGG - Intergenic
1107812657 13:44215321-44215343 TGGAGCCTTCAGAGGGGGCATGG - Intergenic
1108698469 13:52923622-52923644 GTCAGGCTGCAAAAGGGGCAGGG - Intergenic
1110492871 13:76129482-76129504 TTGAGGCATCAGAAAGGGCATGG - Intergenic
1112117522 13:96372982-96373004 TGGAGCCTTCAGAAGGAGCATGG - Intronic
1112772197 13:102803612-102803634 ATGAGGATATAAAAGGGGCAGGG + Intronic
1116666041 14:47776932-47776954 TTGAGGTTACAGAAGGAATAGGG + Intergenic
1119535564 14:75400168-75400190 TAGAGGCAAAAGAAGGGGGAAGG - Intergenic
1120847055 14:89135487-89135509 TTCAGGCTACAGAACAGGGAGGG + Intronic
1121018066 14:90560522-90560544 TTGAGGATTCAGAAAGGGAAAGG + Intronic
1121249864 14:92491491-92491513 TTTAGGCTTCAGGAAGGGCATGG + Intronic
1121430144 14:93880755-93880777 CTGAGGATGCAGAAGGGCCAGGG - Intergenic
1121688490 14:95857349-95857371 TGGAGGCAGCAGAAGGGGCCTGG - Intergenic
1122104478 14:99441738-99441760 ATGAGGCCACAGCAGGGGCAGGG + Intronic
1122287454 14:100660038-100660060 TGGAGGGGACAGAAGGGACAGGG + Intergenic
1122982771 14:105199059-105199081 AGGAGGCTACAGAAGGGCTATGG - Intergenic
1126423231 15:48498051-48498073 GTGAGGGTACAGAAGAGGGAGGG - Intronic
1128545221 15:68561992-68562014 TTTAGGGTAGAGAAGGGACAAGG - Intergenic
1128922724 15:71627121-71627143 CTGAGGTTACAGAAAGGGAAAGG + Intronic
1129363997 15:75043355-75043377 TGGAGGCCACAGGAGGGTCAGGG - Intronic
1129712137 15:77825831-77825853 TTGAGGACTCAGAAGGGACATGG - Intergenic
1130569698 15:85030601-85030623 ATGAGGCTGCAGAGGGGTCAGGG - Intronic
1131254055 15:90849998-90850020 TGGAGGCTAAAGCAGGGGGATGG + Intergenic
1131483610 15:92802438-92802460 TGGAGGCTTCAGAAAGAGCATGG - Intronic
1131606806 15:93913597-93913619 TGCAGGCTACAGAAGAGGAATGG - Intergenic
1131802701 15:96088027-96088049 ATGAGGTTAGAGAAGGGGGAAGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133955043 16:10435267-10435289 TTGAGGTTTCATAAGGAGCATGG + Intronic
1134668391 16:16036647-16036669 TTGAGGCCACAGGAGTGGAAAGG - Intronic
1134783599 16:16920970-16920992 TTTAGGGTTCAGAAGGGGCAGGG + Intergenic
1134907947 16:17997775-17997797 TTGGGGCTACAGAAGAGTCAAGG + Intergenic
1137497358 16:48981070-48981092 ATGAGACTGCAGAAGGGCCATGG - Intergenic
1138093675 16:54195822-54195844 TTGCATCTCCAGAAGGGGCAGGG + Intergenic
1139338223 16:66248496-66248518 TGGAGGCGGCAGAAGGGGCTGGG - Intergenic
1140471777 16:75219264-75219286 CTGAGGCTCCAGAAGTGGCTGGG + Intronic
1141094532 16:81153694-81153716 TTGATGCTGCAAAAGGGCCAAGG + Intergenic
1141117463 16:81322394-81322416 TGGAGGCTCCAGAAGGGCAAAGG - Intronic
1141224318 16:82100792-82100814 CTCAGGCTACAGAAGAAGCAGGG + Intergenic
1141812878 16:86387840-86387862 TGGAGGCTTCAGAGGGAGCAGGG - Intergenic
1142001524 16:87667058-87667080 CAGAGGCTGCAGAGGGGGCACGG - Intronic
1142822233 17:2479364-2479386 TTGAGGCAACATAAGGGGCTGGG - Intronic
1143769287 17:9157757-9157779 TTGAGGGACCAGCAGGGGCAAGG - Intronic
1145254004 17:21312940-21312962 TTGAGGTTACAGAAGGAATAAGG + Intronic
1145393882 17:22478575-22478597 TTGAGACTACAGAAGGAACAGGG + Intergenic
1146294734 17:31640744-31640766 TTGAGGCTTTTGAAGGGGCAGGG - Intergenic
1149439530 17:56663036-56663058 CTGAGGATACGGAAGAGGCAGGG + Intergenic
1150684423 17:67309135-67309157 TGGAGGCTTCAGAGGGAGCATGG + Intergenic
1150976510 17:70093301-70093323 TAGAGGCTTCAGAAGGAGCAAGG - Intronic
1151259060 17:72902434-72902456 TTGAGCCTTCAGAGGGAGCATGG + Intronic
1152210271 17:78999379-78999401 TTGGGACTAGAAAAGGGGCAGGG - Intronic
1152371152 17:79889342-79889364 TCCAGGCTAGAGCAGGGGCAGGG - Intergenic
1153219721 18:2850918-2850940 TTCAGGCTCCAGAAAGGCCATGG + Intronic
1153660943 18:7325732-7325754 CTGAGGGAACAGAAGGTGCAAGG + Intergenic
1155517970 18:26641716-26641738 TTGTGCCTAAAGAAGGGGCATGG - Intronic
1157242324 18:46022742-46022764 TTGAGGATACAGAAGTGACCAGG - Intronic
1157762088 18:50272775-50272797 TTGGGGCTACAGCAGGGTCAGGG + Intronic
1159413418 18:68111381-68111403 TTGCAGCCAGAGAAGGGGCAAGG - Intergenic
1160037960 18:75318954-75318976 TAGAGGCTTCAGAGGGAGCATGG - Intergenic
1160417520 18:78721433-78721455 TGGGGGCTTCAGAAGGGGAAGGG + Intergenic
1160662878 19:309187-309209 CTGATGCTACAGAAGGGAAAGGG - Intronic
1161379606 19:3958126-3958148 ATGTGGCTCCAGACGGGGCAGGG + Intergenic
1161709329 19:5838963-5838985 TTGAAGCCACAGGTGGGGCAAGG - Exonic
1161711608 19:5851644-5851666 TTCAGGCTACAGATGGAGCCCGG - Intergenic
1163556055 19:17993423-17993445 TGGAGGCTGCAGTGGGGGCAGGG - Intronic
1165077311 19:33287001-33287023 TTGCGGGTGCAGATGGGGCATGG + Intergenic
1166156257 19:40913371-40913393 TTTAGGCTACTCAAGGGTCAGGG - Intergenic
1167687184 19:50963597-50963619 TTGAGGCTTCAGAGAGGGCTGGG + Intronic
1168593245 19:57653823-57653845 TTGATACCACAGATGGGGCAAGG - Intergenic
925121875 2:1425027-1425049 ATGACTTTACAGAAGGGGCACGG - Intronic
925121901 2:1425416-1425438 ATGACTTTACAGAAGGGGCACGG - Intronic
925618686 2:5769025-5769047 GTGAGGCTACAGAAAAGCCAGGG + Intergenic
926679675 2:15654032-15654054 TGAAGGCCACAGAAGGGGCCGGG - Intergenic
927525200 2:23733700-23733722 ATGAGGGTAAAGAAGGGGCCTGG - Intergenic
930127365 2:47812126-47812148 TTGAGGCTACAGAAGGGGCAAGG - Intronic
931952595 2:67381991-67382013 TGGAGGCTGAAGAAGGGGAAGGG + Intergenic
935179015 2:100673966-100673988 AGGATGCTACAGAAGGGGCCTGG - Intergenic
936821472 2:116527360-116527382 TAGAAGCCACAGAAGAGGCATGG - Intergenic
936978648 2:118243531-118243553 TTGAGGCTGGACAAGAGGCAGGG + Intergenic
937879219 2:126852448-126852470 TGGAGGCTTGAGAAGGGGGAGGG - Intergenic
938146726 2:128840609-128840631 CTGAGTTGACAGAAGGGGCATGG + Intergenic
938422380 2:131155391-131155413 GGGAGGCTCCAGAAGGTGCAGGG - Intronic
940112251 2:150167721-150167743 TTGAGGGTACGGATGGGGAAAGG + Intergenic
944547153 2:200810439-200810461 TTGAGGCAACAGCAGTGGGAAGG - Intergenic
944713869 2:202359888-202359910 TTTAGCCTGGAGAAGGGGCAGGG + Intergenic
944884514 2:204048967-204048989 TTGAGGTTACAGAAGTAGGAGGG + Intergenic
948206580 2:236165895-236165917 CTGAGGGTCCAGAAGGGCCAGGG - Exonic
1169279937 20:4258298-4258320 ATGAGGCTATGGAAGGGGTATGG - Intergenic
1169495671 20:6112759-6112781 TTGAAGAAACAGAAGGGGAAAGG + Intronic
1169940208 20:10928654-10928676 ATTAGGCTAGAGAAAGGGCAGGG + Intergenic
1170420841 20:16191474-16191496 TGGAGGCTGGAGATGGGGCATGG - Intergenic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172566633 20:35935667-35935689 ATGAGGATTCAGAAGGGACAAGG - Intronic
1172837575 20:37882939-37882961 CTGAGGCCCCAGAAGGGGAAGGG + Intergenic
1173660185 20:44727673-44727695 TTGAGGCTGCAGCAGGTGCTGGG + Exonic
1173866667 20:46316920-46316942 CTGAGGCCACAGATGGGACAAGG + Intergenic
1174633568 20:51979449-51979471 TGGAGGTTTCAGAAAGGGCACGG + Intergenic
1174882606 20:54296783-54296805 TTGAGCTTACAGTAGGGGAAGGG - Intergenic
1175492589 20:59389303-59389325 TGGAGGCTTCAGAAGGCGCTTGG - Intergenic
1176210106 20:63915647-63915669 TTGAGGCTGCAGGAATGGCAGGG + Intronic
1176929992 21:14797915-14797937 TGAAGGCTACAGAAGGAGAAAGG + Intergenic
1177364571 21:20117443-20117465 TCGATGCTACTGATGGGGCATGG - Intergenic
1177596730 21:23253444-23253466 ATGAAGCTACAGAAGCCGCATGG - Intergenic
1178931113 21:36820126-36820148 ATGAGGCAAAGGAAGGGGCAGGG + Intronic
1179103511 21:38377682-38377704 TTGAGGCTAAGGAAGGGGTGGGG - Intergenic
1179570251 21:42274359-42274381 TTGGGGCCACAGAAGGGTCCAGG + Intronic
1179919938 21:44502654-44502676 TTGTGGCTACACCCGGGGCAGGG + Intronic
1180141422 21:45895806-45895828 TTGAGGCCACAGCAGAAGCAGGG + Intronic
1182727139 22:32456910-32456932 TTGGGGCTTCAGAAAGGGCTTGG - Intronic
1182782039 22:32875785-32875807 TGGAGCCTTCAGAAGGAGCATGG + Intronic
1182841949 22:33398251-33398273 TTGGGGATAGAGATGGGGCATGG - Intronic
1183803749 22:40191052-40191074 TTGAGGATAGAGAAGAGGAAGGG + Intronic
1184306326 22:43605029-43605051 ATGAGGCTACAGCAGGTGCTCGG + Intronic
1185403273 22:50629559-50629581 TTGAGGTTACAGAAAGAACATGG - Intergenic
1185404540 22:50640163-50640185 TTGAGGTTACAGAAAGAACATGG - Intergenic
949896414 3:8770139-8770161 TTTAGAATAGAGAAGGGGCAGGG - Intronic
949966255 3:9359025-9359047 TTGAGGTTACAGAAAGAACACGG + Intronic
950166446 3:10803992-10804014 AGGAGGCTACACAGGGGGCAGGG - Intergenic
951147650 3:19247877-19247899 TTGAGGCTACAAAGGGAGAATGG + Intronic
952744357 3:36763827-36763849 GTGAGGCTGCAGAAGGGAGAAGG - Intergenic
953232064 3:41074176-41074198 TTGGGGCTAGTGAGGGGGCAGGG - Intergenic
954663081 3:52236526-52236548 TTGAGGCTGCCCAAGGGTCAGGG + Intronic
954701645 3:52453811-52453833 TTGAGGATGCAGAAGGGGTAGGG - Intronic
955757716 3:62242679-62242701 ATGAGGCCAAAGAAGGGGCTAGG - Intronic
957307441 3:78476020-78476042 TTGAGGCTTCTGAAGGGGTGGGG + Intergenic
957318114 3:78594206-78594228 TTCAGGCTGCAGGCGGGGCAGGG - Intergenic
959502170 3:107119059-107119081 TTGACCCAACAGAAGGAGCATGG - Intergenic
959906317 3:111714595-111714617 TTGAAGCTACAGCATGGGCATGG - Intronic
960387263 3:117035399-117035421 TGGAGACCACAAAAGGGGCAAGG + Intronic
960637358 3:119796568-119796590 TTTCTGCTACAGAAGGAGCAAGG - Intronic
961564492 3:127754006-127754028 CTGTGGCTACAGAATGGGCTAGG - Intronic
961999665 3:131282581-131282603 TAGAGGCTGCAGAAGGCACAGGG + Intronic
962291493 3:134140568-134140590 GTTAGGCTACACAAGGGTCAGGG - Intronic
962319404 3:134378088-134378110 GTGAGGTTACACAATGGGCAGGG + Intergenic
962624506 3:137211707-137211729 GTTAGGCTACAGGAGGGTCAGGG - Intergenic
963042842 3:141081991-141082013 TTGGGGATACAGGAGGGACATGG - Intronic
963970619 3:151425681-151425703 TTGTGGTTACAGCAGGAGCATGG + Intronic
965722611 3:171678132-171678154 TTGAGGAAAAAGAAGTGGCATGG - Intronic
967586970 3:191225812-191225834 TGGAGGCTACAAAAGGTGGAAGG + Intronic
967708184 3:192676807-192676829 TTGAAGCTAAGGAAGAGGCATGG + Intronic
969173691 4:5383718-5383740 ATGAGGCATCAGCAGGGGCAGGG + Intronic
970438789 4:16061759-16061781 TAGAGGCTTCAGAAGGACCATGG - Intronic
970523471 4:16908567-16908589 TAGAGCCTTCAGAGGGGGCATGG + Intergenic
974325680 4:60412238-60412260 TACAGGCTTCAGAAGGAGCATGG - Intergenic
975122755 4:70746886-70746908 TTGAGGATGGAGTAGGGGCAAGG + Intronic
976542702 4:86296323-86296345 CTGAGGCTTCAGAAGTGGTAGGG + Intronic
978483080 4:109216680-109216702 TAGAGGCTTCAGAGGGAGCATGG + Intronic
979615589 4:122739135-122739157 TTGATCCTTCAGAAGGAGCATGG + Intronic
982449200 4:155531936-155531958 TGGAGGCTTCAGAGGGAGCATGG + Intergenic
988687660 5:33540515-33540537 GTTAGGCTACACAAGGGTCAGGG - Intronic
990151968 5:52828793-52828815 TAGAGGCTTCAGAAGGAGTATGG - Intronic
990168085 5:53017615-53017637 GTGGGGCTCCAGAAGGAGCAGGG + Intronic
990325108 5:54667536-54667558 TTGAGGATGCAGAAGGGTGAGGG - Intergenic
992816331 5:80443511-80443533 TTGGGGCTACAAAAGGGGAGAGG + Intronic
993497385 5:88622906-88622928 TTTAGGCTACACAGGGGTCAGGG + Intergenic
994657395 5:102610461-102610483 ATGAGGCTGGAGAAGAGGCAGGG - Intergenic
995441896 5:112201652-112201674 TTGAGGCGACATAGGTGGCAGGG - Intronic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
996005604 5:118417730-118417752 ATGAGTCTGCAGAAGGAGCATGG - Intergenic
998230247 5:140357183-140357205 TTGGGGCCACAGAAAGGGCAAGG + Intergenic
998942619 5:147301096-147301118 TTGAGGTTACAGAAAGAGCTTGG + Intronic
999230313 5:150057860-150057882 TTGAGGGTAGAGCAGGGGCTAGG - Intronic
999694065 5:154172876-154172898 CTGAGGCTGAAGATGGGGCAAGG - Intronic
1000230894 5:159314132-159314154 TTTGGGCTAAAGAATGGGCAGGG - Intergenic
1000393319 5:160747651-160747673 TAGAGGCTTCAGAGGGGGCATGG + Intronic
1001170002 5:169410268-169410290 TAGAAGCTTCAGAGGGGGCATGG + Intergenic
1002073231 5:176693048-176693070 TGGAGGCTGCAGTGGGGGCAGGG + Intergenic
1002779358 6:354400-354422 AAGATGCTACAGAAGGGGCTGGG + Intergenic
1003228706 6:4229687-4229709 GTCAGGCTACACAAGGGTCAGGG - Intergenic
1004567170 6:16808679-16808701 TGGAGGCTTCAGAGGGAGCATGG - Intergenic
1004785337 6:18962068-18962090 TAGATGCTGCAGAAGGGGGATGG - Intergenic
1004962762 6:20810241-20810263 CTGGGGCAAGAGAAGGGGCAAGG - Intronic
1005792388 6:29317582-29317604 ATCAGGCTACAGAAGGGAAAGGG - Intergenic
1006937040 6:37725769-37725791 TGGAGGCCACACAAGCGGCAGGG + Intergenic
1008156100 6:48016249-48016271 TTGAGGCTACAGAAGGCAGCAGG + Intronic
1009481981 6:64170445-64170467 TAGAGCCTTCAGAAGGGGTATGG - Intronic
1011046431 6:83088302-83088324 TTGAGACAACAGTAAGGGCATGG + Intronic
1013041497 6:106438439-106438461 TAGAGCCTTCAGAAGGAGCACGG - Intergenic
1013659474 6:112280249-112280271 TTTAGGGCACAGAAGGGGCTTGG - Intergenic
1013996387 6:116313228-116313250 TGTAGGCTTCAGAAGGAGCATGG + Intronic
1014695069 6:124610074-124610096 TGGAGGCTAAAGAAGTGTCATGG + Intronic
1014707978 6:124771871-124771893 TTCATGCAACAGCAGGGGCAAGG + Intronic
1015939501 6:138433488-138433510 ATCAGGGCACAGAAGGGGCAAGG - Exonic
1016646614 6:146416893-146416915 TTTAGGCTACACAAGGCACAGGG - Intronic
1021227796 7:18048855-18048877 TTGCTGGTACACAAGGGGCATGG + Intergenic
1023535413 7:41203559-41203581 CTGTGTCTACATAAGGGGCAAGG + Intergenic
1025171317 7:56759591-56759613 TTCAGGCTACAGAGCGGGGATGG - Intergenic
1025700550 7:63815896-63815918 TTCAGGCTACAGAGCGGGGATGG + Intergenic
1031132004 7:117843618-117843640 TTGAGGCCACAGAAAGGCCTTGG + Intronic
1032330982 7:130979226-130979248 TTGAAGCCACAGCAGGGGCAAGG + Intergenic
1035615939 8:1001877-1001899 TTGAGGCTCAAGAAAGGGCTTGG + Intergenic
1035837073 8:2765863-2765885 GTCAGGCCACAGAAGGAGCATGG - Intergenic
1039328628 8:36512541-36512563 TAGAGGCTCCAGAGGGAGCACGG + Intergenic
1039944877 8:42120455-42120477 TTTAGGCTGCAGAATGGGCTGGG + Intergenic
1040309672 8:46230281-46230303 ATGAGGCTGCAGAGGGGGCATGG + Intergenic
1040892998 8:52336895-52336917 CAGAAACTACAGAAGGGGCATGG - Intronic
1041547510 8:59062192-59062214 TTGAGGGTGGAGAAGGGGTAAGG + Intronic
1041665873 8:60444415-60444437 TTTAGGCTACACAGGGGTCAGGG + Intergenic
1043438667 8:80257963-80257985 TTGAGGCTACATAGGGAACAGGG - Intergenic
1047221738 8:122924198-122924220 TAGAGGCTTCAGAGGGAGCACGG - Intronic
1047796461 8:128261050-128261072 TTGAGGCTTCAGAAGCCACATGG + Intergenic
1048003352 8:130397790-130397812 CTGGGGCCACAGGAGGGGCATGG - Intronic
1049667732 8:143854455-143854477 TTGAAGTTCCAGAAGGGGAATGG + Intergenic
1054783110 9:69184395-69184417 TTGAGGCTGGTGAAAGGGCAGGG + Intronic
1055161821 9:73139077-73139099 CTGAGGGTACAGAATGGGAAGGG + Intergenic
1057814580 9:98285186-98285208 AGGAGGCTAAAGAAGGGTCAAGG - Intergenic
1058621584 9:106888867-106888889 TTGAGGTTCCAGAAGGAACATGG - Intronic
1059651115 9:116316910-116316932 TTGAGGCTATAGGAGGGGATGGG + Intronic
1060191797 9:121598567-121598589 TGGAGGCCCCAGCAGGGGCAGGG - Intronic
1061201175 9:129139371-129139393 TTGAGGCAGCAGAAGGAACAGGG + Intronic
1061347755 9:130041174-130041196 TTGAGGGTGCAGAAGTGGGAAGG - Intronic
1061487917 9:130929622-130929644 ATGGGGCTGCGGAAGGGGCATGG - Exonic
1186095525 X:6097655-6097677 TTTAGGATACATAAGGGTCATGG - Intronic
1188813120 X:34677636-34677658 TTGCTGCTACAGAAGGCACAGGG - Intergenic
1189512330 X:41675456-41675478 TTGTGGCTTCACAAGGGCCAGGG - Intronic
1189683844 X:43543518-43543540 TTGAGGTTACAGAAAGAACAGGG - Intergenic
1189959406 X:46309983-46310005 TTGAGGTTACAGAAAGAACAGGG + Intergenic
1190870394 X:54420178-54420200 ATGAGGCTAGAGAGGTGGCAAGG + Intergenic
1191668864 X:63730696-63730718 ATGAGGCATCAGAAGAGGCAAGG - Intronic
1192993544 X:76488145-76488167 TTGAGTCTACAGAGGCAGCATGG + Intergenic
1193427853 X:81361625-81361647 TGGAGACTACAGAAGGGGGCAGG + Intergenic
1194108019 X:89796059-89796081 TTTAGACTACAGAAGTGCCATGG + Intergenic
1195572067 X:106407716-106407738 TTTAGGCTACTGAGGGGTCAGGG - Intergenic
1197899809 X:131358520-131358542 TTGAAGTTCCAGAAAGGGCAAGG - Intronic
1197912022 X:131493029-131493051 GTGAGGTTTCACAAGGGGCAGGG - Intergenic
1198530365 X:137546144-137546166 TTGAAGATATAGATGGGGCAGGG + Intergenic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199215021 X:145253144-145253166 TTGATACCACAGATGGGGCAAGG + Intronic
1200460676 Y:3450790-3450812 TTTAGACTACAGAAGTGCCATGG + Intergenic
1201503054 Y:14666704-14666726 TTTAGGATACATAAGGGTCATGG + Intronic
1201902509 Y:19057925-19057947 TTGAGGCTACTGAGGTGGGATGG + Intergenic
1202459398 Y:25092617-25092639 TTTAGGCCACAGAAAGGGCCAGG + Intergenic