ID: 930128174

View in Genome Browser
Species Human (GRCh38)
Location 2:47820653-47820675
Sequence GGATTCAAAATGTGGCAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930128174 Original CRISPR GGATTCAAAATGTGGCAGCT CGG (reversed) Intronic
901147438 1:7075566-7075588 GGAACCAAAATGTGACAGCAGGG - Intronic
902723185 1:18317949-18317971 GGATTCAAAGCTGGGCAGCTAGG + Intronic
904084940 1:27899556-27899578 GGATTCAAAATGTTGTATATGGG - Intronic
904926124 1:34049532-34049554 TGATTCAAAAGATGGCATCTGGG - Intronic
905771557 1:40641425-40641447 GGATTCAAACTCTAGCAGTTGGG - Intronic
909022776 1:70450554-70450576 GGATTCAAATTCAGGCAGCATGG - Intergenic
909484491 1:76158173-76158195 GGATTCAAATTCTGGCAGCATGG - Intronic
912239926 1:107895560-107895582 GGATTCAAACTGAGGCAGCCTGG + Intronic
916945699 1:169724989-169725011 GGATTCAAACTCTGGCAGTCTGG - Intronic
917072845 1:171171047-171171069 TGTTTCAAAATATGACAGCTTGG - Intergenic
917258990 1:173147479-173147501 TGATTCAACATGTGGCACTTAGG + Intergenic
918653890 1:187000048-187000070 GAATTCAAAAGGAGGCAGTTGGG - Intergenic
919097245 1:193052596-193052618 GCATTCAAACTCTGGCAGTTTGG - Intronic
920358076 1:205390908-205390930 GGATTCCAAAAGGGGCAGCGAGG + Intronic
921374341 1:214458656-214458678 GGATTCAAACTCAGGCAGTTTGG + Intronic
922553681 1:226516995-226517017 AGATTGTAAATGTGGAAGCTAGG - Intergenic
922644300 1:227270409-227270431 TGATTAAAAATATGGCATCTGGG + Intronic
922973545 1:229763246-229763268 GAATGCAAAATGGGGCACCTAGG - Intergenic
923251271 1:232181379-232181401 GCCTACAAAGTGTGGCAGCTAGG + Intergenic
1065335290 10:24651167-24651189 GGATCCAAAGGGCGGCAGCTGGG - Intronic
1072639565 10:97201782-97201804 GCATGCAAACGGTGGCAGCTGGG - Intronic
1072709249 10:97705229-97705251 GGATTCAGATTCTGGCAGTTTGG + Intergenic
1073615092 10:104986507-104986529 GCATTCACAATGTGGCTGTTTGG + Intronic
1074402277 10:113151994-113152016 GGATTCAGAATGTGGCTGAAGGG - Intronic
1074602992 10:114934300-114934322 GGATTCAAACTATGGCTCCTGGG - Intergenic
1075165766 10:120066992-120067014 TCATTCTAAATGGGGCAGCTGGG - Intergenic
1075483991 10:122805836-122805858 GGATTAATAATGGGGCAGGTGGG - Intergenic
1075797514 10:125131194-125131216 GGATTCAGAACGTAGCAGCTGGG + Intronic
1077424042 11:2466205-2466227 AGCTACAAAATGGGGCAGCTGGG - Intronic
1078271559 11:9799610-9799632 GGATTCTAAACGTGGTATCTAGG - Intronic
1078555521 11:12322330-12322352 GGATTCTTCATGGGGCAGCTAGG - Intronic
1079341309 11:19613697-19613719 GGATTCCAACTCTGGCCGCTTGG - Intronic
1079455680 11:20634163-20634185 GGATTAAAAAACTGGCAGCCAGG - Intronic
1081244057 11:40742313-40742335 GGATACAAAACATGGCAGATAGG + Intronic
1081529955 11:43951411-43951433 GGAATTAAAATGGGCCAGCTGGG + Intergenic
1084763782 11:71294275-71294297 GGATTCCAAAGATGGCATCTGGG + Intergenic
1084945373 11:72635398-72635420 TGATTCTAAATGGGGCTGCTGGG - Intronic
1086284187 11:85226611-85226633 GAATTCAAAATGTGGAAAATGGG + Intronic
1086320004 11:85635884-85635906 TGAATCAAAATGTGGTAGTTTGG + Intronic
1087581074 11:100054356-100054378 GAATGCAAAATGTGGGACCTTGG - Intronic
1090851588 11:130575419-130575441 GGGTTCAAAATGTGGCTTCTTGG + Intergenic
1091464126 12:669115-669137 GGATTCTAAATGTGGAATTTTGG - Intergenic
1093507844 12:19889350-19889372 GTGTTAAAAAAGTGGCAGCTTGG + Intergenic
1094270197 12:28605714-28605736 GGATTCAAATTCAGACAGCTGGG - Intergenic
1095941581 12:47730805-47730827 GGATTCAAACCCAGGCAGCTTGG - Intergenic
1096277127 12:50219070-50219092 AGATTCAAAAAGTAGCAGTTGGG + Intronic
1096889154 12:54749082-54749104 GGATTCAAACTCAGGCAGCCTGG + Intergenic
1097957728 12:65503761-65503783 CAATCCAAAATGTGCCAGCTTGG + Intergenic
1098016328 12:66108530-66108552 GCATTCAAAAAGAGACAGCTGGG - Intergenic
1098393263 12:69991882-69991904 AGAATCCAAATGTGGCATCTGGG + Intergenic
1100387715 12:94119039-94119061 GCATTCAAAATGTGACTGGTAGG + Intergenic
1101367842 12:104092170-104092192 AGATTTTAAATGTGGCGGCTGGG + Intronic
1108948711 13:56059429-56059451 GGATACAAAATGTTGATGCTGGG - Intergenic
1109019693 13:57072896-57072918 ACATTCAAAATGTGTCAGATTGG - Intergenic
1109201706 13:59438579-59438601 GTAGTCAAAATGTGGAAGGTAGG - Intergenic
1109842031 13:67931202-67931224 TAATTCAAAATGTGGAAGCCAGG - Intergenic
1109900416 13:68762125-68762147 GGATTCAAGATATGGCACCTGGG - Intergenic
1110205432 13:72906742-72906764 GGAATCAAAATGTTGAAGATGGG - Intronic
1112030305 13:95450519-95450541 GAATTCAAAAGGAGGAAGCTTGG - Intronic
1115665363 14:35539312-35539334 GCCCTCAAAATATGGCAGCTTGG + Exonic
1115984150 14:39086181-39086203 GTATTCAAAATGTGGTTTCTGGG - Intronic
1117140741 14:52789106-52789128 GGATTCAAAATGAGGCAACAGGG + Intronic
1117289093 14:54315234-54315256 GGAGGCAAAATGTGGCTGGTAGG + Intergenic
1117993833 14:61460211-61460233 CCATTAAAAATGAGGCAGCTTGG - Intronic
1118539298 14:66804831-66804853 GGATGCAAAATGTCACAGCAGGG - Intronic
1120434814 14:84467802-84467824 AAATTAAAAATATGGCAGCTGGG - Intergenic
1120449116 14:84643332-84643354 GGATTCATATTCTGGCAGCTGGG + Intergenic
1121690014 14:95871438-95871460 AGATTGAAATTGGGGCAGCTGGG - Intergenic
1125180576 15:36878233-36878255 GCAGTCACACTGTGGCAGCTCGG + Intergenic
1125753300 15:42045178-42045200 GGTTTGGAAAGGTGGCAGCTGGG + Intronic
1125860079 15:42990802-42990824 GGATTCAAACCCAGGCAGCTTGG - Intronic
1126215914 15:46154818-46154840 GGATTGAAAATTTGGCCCCTTGG + Intergenic
1128674117 15:69596196-69596218 GGCTTCAGAAAGTGGCATCTTGG + Intergenic
1131961987 15:97799647-97799669 GGATTCTGAATTTGGAAGCTTGG - Intergenic
1133849006 16:9484400-9484422 GTATTCAAACTGGGGCAGCTTGG + Intergenic
1134181136 16:12048655-12048677 GGAATCAGAATGTGGCGGATGGG + Intronic
1134611969 16:15616232-15616254 GGATTAAAAATAGGGCAACTGGG + Intronic
1134656789 16:15953561-15953583 GGACTTAAAATGTTGCTGCTTGG + Intronic
1135307871 16:21382410-21382432 GGAATCAGAATGTGGCTGATGGG + Intergenic
1136304616 16:29361530-29361552 GGAATCAGAATGTGGCTGATGGG + Intergenic
1140585482 16:76286284-76286306 TAATTCAAAATGTGCCACCTAGG - Intronic
1146244545 17:31268326-31268348 TGATTCAAAATGTGACCACTTGG + Intronic
1146278417 17:31529918-31529940 GGATTCGGAACGTGGCTGCTGGG + Intronic
1146735847 17:35238165-35238187 GATTTCAAAGTGAGGCAGCTGGG + Intergenic
1151268072 17:72971838-72971860 GGATTCCAAATGAGCCATCTGGG + Intronic
1153953320 18:10075249-10075271 ACATTCCAAATGTGGCCGCTGGG + Intergenic
1154982294 18:21513184-21513206 GGATTCAAAATCAGACAGTTTGG + Intronic
1155532900 18:26785663-26785685 GGATTCCACATGTGGCACCCTGG - Intergenic
1158846349 18:61446895-61446917 GGTTTCCACATGTGGCAACTTGG - Intronic
1161913558 19:7212412-7212434 CGATTCAACATGTGTCTGCTAGG - Intronic
1164476595 19:28580203-28580225 GGATTCAGAATCTGGCTGCCAGG - Intergenic
1165949857 19:39468174-39468196 GGATTCAAAAGCAGGCAGGTGGG - Intronic
1166601592 19:44100516-44100538 GGACTCTAAATGTGGCATCCTGG - Intronic
1167251412 19:48400213-48400235 GGATTGAGAATGGGTCAGCTAGG + Intronic
1168534108 19:57154856-57154878 GGATTGAAAAGGTGGGGGCTGGG - Intronic
925683269 2:6445363-6445385 TGATTCAGAATGTGGCTGCCTGG + Intergenic
925776651 2:7342645-7342667 GGTTTCTAAATCTGGCATCTTGG - Intergenic
925961563 2:9021963-9021985 TGATTCACATGGTGGCAGCTGGG + Intergenic
926045883 2:9709368-9709390 GGCTTAAAAATGAAGCAGCTTGG + Intergenic
930128174 2:47820653-47820675 GGATTCAAAATGTGGCAGCTCGG - Intronic
931033189 2:58207358-58207380 GGACTCAAAATGTGGCTAGTGGG + Intronic
931257746 2:60588387-60588409 GGATTTGTAATGTGTCAGCTTGG + Intergenic
931680868 2:64748821-64748843 AGATTCAAACTCTGGCAGCATGG + Intronic
932431051 2:71673682-71673704 GGACTCAAACCCTGGCAGCTGGG - Intronic
933736288 2:85497581-85497603 GGATTAAAAAACTGGCTGCTTGG + Intergenic
933765391 2:85705081-85705103 GGCTTCACACTGTGGCAGGTGGG - Intergenic
933815389 2:86064040-86064062 GGATTCAAGATGTGGCCTCTGGG - Intronic
937228293 2:120382333-120382355 GGAGTGAAAATCTGGCTGCTGGG - Intergenic
940121048 2:150266296-150266318 GGATTCAAAATGGTGCATATAGG - Intergenic
940596577 2:155801234-155801256 GTATTTAAAGTGTGGCAGCAGGG + Intergenic
945690905 2:213034331-213034353 GCATTCACAATGTGGCTGTTTGG + Intronic
945913317 2:215674940-215674962 TGATACAAAATGTGGCAGGTAGG - Intergenic
948313946 2:237012581-237012603 GGATTCAGCATGTGGCTGTTGGG - Intergenic
1170260100 20:14395657-14395679 GGTTTCTTAAAGTGGCAGCTAGG + Intronic
1170362170 20:15558304-15558326 AGATTGAAAGTTTGGCAGCTGGG - Intronic
1171753914 20:29082365-29082387 GGATTTAAAATCTGGCAGTGCGG + Intergenic
1171788330 20:29495170-29495192 GGATTTAAAATCTGGCAGTGTGG - Intergenic
1171859223 20:30379348-30379370 GGATTTAAAATCTGGCAGTGTGG + Intronic
1173376125 20:42484895-42484917 GGAAGCAGAATGTGGCAGCTAGG - Intronic
1180410729 22:12604433-12604455 GGATTTAAAATCTGGCAGTGTGG + Intergenic
1183105848 22:35614521-35614543 GAATTCAAATTCAGGCAGCTTGG - Intronic
951444531 3:22763448-22763470 GGTTTCAGAATGCAGCAGCTAGG - Intergenic
954844996 3:53547663-53547685 GGGTTCAAAATGTGCCTCCTCGG - Intronic
955548934 3:60062020-60062042 TGACTCAAAATAAGGCAGCTGGG + Intronic
956169279 3:66419872-66419894 TGATTCAAAATGTTCTAGCTTGG + Intronic
958731263 3:97962851-97962873 GGATTCAAATTCAGGCAGCATGG + Intronic
959576631 3:107941274-107941296 GGATTCGAAATCAGACAGCTGGG - Intergenic
960097962 3:113706353-113706375 GCATTCAAAACTTGGCTGCTTGG + Intergenic
960934156 3:122886527-122886549 GGATTCATCATGAGGCAGCATGG + Intergenic
964276450 3:155013303-155013325 GGATTCAAACCCAGGCAGCTGGG + Intergenic
966400416 3:179541917-179541939 GGATTCTCAATGTTGCAGTTGGG - Intergenic
967699577 3:192575836-192575858 CTATTCATAAAGTGGCAGCTAGG - Intronic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
969179023 4:5423237-5423259 GGCTTCAGCATGAGGCAGCTGGG + Intronic
970442165 4:16090690-16090712 GGATTCGGAATGTGAAAGCTGGG + Intergenic
973287201 4:48431879-48431901 GGATTCGACATATGGCATCTGGG - Intergenic
974072839 4:57140805-57140827 AGTTTCAAAATGTGGCCTCTGGG + Intergenic
974389906 4:61252719-61252741 TGATTCAAAATGTGACATTTTGG + Intronic
975324735 4:73046614-73046636 GCATTCACAATGTGGCTGTTTGG + Intergenic
976061933 4:81138427-81138449 GGATTCAAGCCTTGGCAGCTTGG - Intronic
976507838 4:85869914-85869936 GGATTCAAATTGAGGCAGTGTGG - Intronic
977277550 4:94996557-94996579 AGTGTCAAAATGTGGAAGCTGGG + Intronic
978416707 4:108484548-108484570 GTATTCAAAATCTGGCAGAGAGG - Intergenic
981644599 4:146984947-146984969 GGATTTAAAAGGCAGCAGCTGGG + Intergenic
982400334 4:154959694-154959716 GGATTCAAACCGAGGCAGTTGGG - Intergenic
985437362 4:189942969-189942991 GGATTTAAAATCTGGCAGTGTGG + Intronic
986266951 5:6198894-6198916 GGATGCAGAATGTGGGGGCTAGG + Intergenic
991436469 5:66601442-66601464 GGTTTCAAAAAGTGGCAAATGGG + Intronic
991584480 5:68187970-68187992 TGAATCACAATGGGGCAGCTTGG + Intergenic
993269779 5:85780575-85780597 GGATGCCAAATTTGGCAGATTGG + Intergenic
993465018 5:88234523-88234545 GAATACAAAATGTAGTAGCTGGG - Intronic
995840301 5:116437455-116437477 TGATTCTTAATTTGGCAGCTTGG - Intergenic
996413913 5:123188843-123188865 CCATTTAAAATGTGGTAGCTGGG - Exonic
998049414 5:139019453-139019475 GTATTCAAAATGTTCTAGCTAGG - Intronic
999531107 5:152464403-152464425 GGATTCAAAGTTAGGCACCTGGG - Intergenic
999674546 5:153985975-153985997 GGATTTAAAGTCAGGCAGCTTGG - Intergenic
1003862124 6:10331990-10332012 GGATTCTAAATGTCACAGCATGG + Intergenic
1004913866 6:20313239-20313261 GGAGTCACAAGGTGGCAGCGGGG - Intergenic
1006419992 6:33927054-33927076 GGAAGTAGAATGTGGCAGCTAGG + Intergenic
1006548995 6:34804845-34804867 AGATTCAAAATCTGGCAGTCTGG - Intronic
1009406399 6:63318747-63318769 GGACTAAAATTGTGGGAGCTGGG + Intronic
1012082139 6:94773419-94773441 GGATGCAAACTGAGGCAGTTTGG + Intergenic
1013341775 6:109221918-109221940 TAAGTAAAAATGTGGCAGCTAGG + Intergenic
1015027856 6:128558464-128558486 GTCATCAAAATGTGGCAGTTTGG - Intergenic
1017595636 6:156025832-156025854 TGACTCAAAATGTTGGAGCTGGG - Intergenic
1018070221 6:160158002-160158024 GGATTCAAAATGAGTTAGCCAGG + Intronic
1019168435 6:170114969-170114991 GGATTCTAACTGTGGCCCCTGGG + Intergenic
1021856674 7:24863794-24863816 GGATTCAAACTGAAGCAGCCTGG - Intronic
1024424109 7:49205957-49205979 GGATTTAAAATGTGCAAGTTGGG + Intergenic
1026378160 7:69773042-69773064 GGATTCAAAAGCTGGCTGTTTGG - Intronic
1031884325 7:127230265-127230287 GGATTAAAAATGGGGAAGGTTGG - Intronic
1032740546 7:134734242-134734264 GAAATAAAAATCTGGCAGCTTGG - Intergenic
1036644266 8:10602099-10602121 GGTCTCAAAATGTGGGACCTAGG + Intergenic
1042214169 8:66412762-66412784 GGATTAAAAAAATGGCATCTTGG - Intergenic
1042389862 8:68221329-68221351 GGACTCAAACTGTGGCTGCTTGG - Intronic
1043370762 8:79589445-79589467 AGCTTCATCATGTGGCAGCTTGG - Intergenic
1045069008 8:98480526-98480548 GAAATCATACTGTGGCAGCTAGG - Intronic
1045838956 8:106557606-106557628 GAATTCAACATGTGGAATCTAGG - Intronic
1047844254 8:128788885-128788907 GGCTTTACAATGTGTCAGCTTGG - Intergenic
1048395459 8:134010242-134010264 GGAGTCTAAATGCGGCAGGTGGG + Intergenic
1048890958 8:138946092-138946114 ACAGTCAAAATTTGGCAGCTAGG + Intergenic
1053655370 9:40213827-40213849 GGATTACAGATGTGGGAGCTTGG + Intergenic
1054367487 9:64360040-64360062 GGATTACAGATGTGGGAGCTTGG + Intergenic
1056344933 9:85683130-85683152 GCATTAACAATGTGGCAGCAAGG - Intronic
1057451916 9:95171025-95171047 GGTTTCAAAATGTATCAGTTTGG - Intronic
1057866984 9:98689256-98689278 GGATTCAAACTGAGGCAGTCTGG - Intronic
1057973681 9:99581279-99581301 GCATTCAAAGTGGGGCAGATGGG - Intergenic
1058493367 9:105526738-105526760 GCCCTCAAAATATGGCAGCTTGG - Intronic
1058778780 9:108312169-108312191 GGAGGCAGAATTTGGCAGCTGGG + Intergenic
1060502421 9:124170988-124171010 TGTTTAAAAATGTGGCACCTCGG - Intergenic
1185852079 X:3498626-3498648 ATGTTCCAAATGTGGCAGCTAGG - Intergenic
1186131374 X:6469613-6469635 TGTTTCAAAATGTGGAAGTTTGG - Intergenic
1189215568 X:39320232-39320254 GGATGGAAACTGTGGCAGCCAGG + Intergenic
1190764906 X:53467881-53467903 GTATTTAAAATGTGGCAAATGGG - Intergenic
1192216434 X:69162578-69162600 GGCTACAAAAGGTGACAGCTCGG - Exonic
1193615199 X:83679019-83679041 GCATTCAAAATGTGGCTGTTTGG + Intergenic
1194867451 X:99086283-99086305 GGTTTAAAAATGTGGCAGTCTGG - Intergenic
1194984937 X:100480204-100480226 GGATTCAAAACCAGGCAGTTTGG - Intergenic
1196020668 X:110987498-110987520 GGAGTCAGAGTGTGGCAGCTTGG + Intronic
1197293671 X:124690592-124690614 GGATTCCAAATGTTGAAGGTGGG + Intronic
1198687972 X:139247988-139248010 GGGTTCTAAATATGACAGCTTGG - Intergenic
1199154809 X:144535318-144535340 GGAATCAAAACATGGCGGCTGGG + Intergenic
1199602278 X:149548711-149548733 GCAATCAAAATGTGTCAGCAGGG - Intronic
1199648109 X:149930764-149930786 GCAATCAAAATGTGTCAGCAGGG + Intronic
1199666227 X:150098558-150098580 GGATTCCAACTTTGGCAGTTTGG - Intergenic
1200419919 Y:2954027-2954049 TAATTCAAAATCTGGCAGATGGG - Intronic
1200810735 Y:7481989-7482011 ATATTCCAAATGTGACAGCTAGG + Intergenic