ID: 930128664

View in Genome Browser
Species Human (GRCh38)
Location 2:47825865-47825887
Sequence TCAGATTTGTCGGCCCGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930128664 Original CRISPR TCAGATTTGTCGGCCCGGCA TGG (reversed) Intronic
902226933 1:15002168-15002190 TAAGATTTTGCGGCCAGGCACGG - Intronic
902512074 1:16972031-16972053 CCAGCCTTGTCGGCCGGGCAAGG + Intronic
903300498 1:22375392-22375414 TCAGATTTGGGGGCCAGGCACGG - Intergenic
904356910 1:29946295-29946317 TCAGATTCATCGGCACAGCAGGG + Intergenic
906069524 1:43007095-43007117 GCAGTCTTGTCGGCCGGGCATGG - Intergenic
908720896 1:67124607-67124629 TGACATTTGTGGGCCGGGCATGG - Intronic
908761513 1:67516677-67516699 TAAGATTTTTCGGCCAGGCGCGG - Intergenic
910943068 1:92558026-92558048 ACAGATTTTTTGGCCAGGCACGG - Intronic
912914699 1:113802244-113802266 TAAGTTTTGTAGGCCGGGCATGG - Intronic
914076619 1:144358382-144358404 TAACATTTGTAGGCCGGGCACGG + Intergenic
914102559 1:144608115-144608137 TAACATTTGTAGGCCGGGCACGG - Intergenic
914171066 1:145223967-145223989 TAACATTTGTAGGCCGGGCACGG + Intergenic
914296338 1:146329092-146329114 TAATATTTGTAGGCCGGGCACGG + Intergenic
915712245 1:157911025-157911047 TAAGATTTGTCTGCCCTGCTGGG + Intergenic
915762228 1:158326260-158326282 ATAGATTTGTGGGCCGGGCATGG - Intergenic
916093261 1:161325908-161325930 GCAGAGTTATCGGCCTGGCACGG + Intronic
918207254 1:182320490-182320512 TAAGATTTGTGGGCCGGGCGCGG - Intergenic
918605307 1:186417251-186417273 TGTGATTTGTTGGCCAGGCATGG - Intronic
919641439 1:200048501-200048523 TCAGACTTGATGGCCCGGCTAGG - Exonic
923178446 1:231492580-231492602 TAAGATTTCTCGGCCGGGCGCGG + Intergenic
1063659716 10:8026320-8026342 TTAGACATGTCGGCCGGGCATGG - Intergenic
1065537925 10:26732828-26732850 ACAGATTTTTAGGCCGGGCACGG + Intronic
1068209752 10:53905625-53905647 TAAGAATTGTCGGCCAGGCATGG - Intronic
1072499914 10:96003744-96003766 ACAGAATTTACGGCCCGGCATGG - Intronic
1073963442 10:108960682-108960704 TCAGAATTTTTGGCCAGGCATGG + Intergenic
1075387479 10:122066691-122066713 ACAGATTTTTAGGCCAGGCACGG - Intronic
1079986084 11:27202223-27202245 ACAGACTTGTCGGCCTGACAGGG + Intergenic
1083402334 11:62432382-62432404 TGAGATTAGTTGGCCAGGCACGG + Intergenic
1084017303 11:66392389-66392411 TATCATTTGTAGGCCCGGCACGG - Intergenic
1086371226 11:86157457-86157479 TCAGATTTACCGGCAGGGCACGG - Intergenic
1088025787 11:105180768-105180790 TCAGGATTGTCGGCCGGGCGCGG + Intergenic
1088387340 11:109274301-109274323 GCAGATTTCTCAGCCAGGCATGG - Intergenic
1089444176 11:118538600-118538622 TGAGAAATGTCGGCCAGGCATGG + Intronic
1089851653 11:121502424-121502446 ATAGAATTGTCGGCCGGGCATGG - Intronic
1090789998 11:130083954-130083976 TCCGATTTCTCGGCCGGGCGCGG + Intronic
1091930825 12:4393990-4394012 ACAGATTTATCAGCCAGGCATGG - Intergenic
1092296452 12:7202864-7202886 GCAGATTTCTGGGCCAGGCATGG + Intronic
1096154395 12:49333901-49333923 TAAAATTTGTCGGCCAGGCGCGG + Intronic
1098383943 12:69898568-69898590 TCAGATTTGTCAGCACAGCAAGG - Intronic
1098553104 12:71786189-71786211 TAACATTTGTAGGCCGGGCACGG - Exonic
1101019412 12:100537998-100538020 GCAGATTTCTCGGCCAGACATGG - Intronic
1102227963 12:111242521-111242543 TTAGATTTGTAGGCCAGACATGG + Intronic
1103910006 12:124346849-124346871 TCAGTGCTGTCGGCCCGGCAGGG - Exonic
1108651182 13:52481476-52481498 TAAGAATTGTTGGCCGGGCACGG + Intergenic
1109996124 13:70129148-70129170 TGATTTTTGTGGGCCCGGCATGG - Intergenic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114422470 14:22596376-22596398 TCAGATTTCTGGGCTGGGCATGG - Intergenic
1115649005 14:35389877-35389899 GGAGATTTGTGGGCCAGGCATGG - Intergenic
1117707144 14:58482100-58482122 TCAGAGATGCCGGCCGGGCACGG - Intronic
1118554960 14:67008162-67008184 TCAGATTAGTCGACCAGGCGTGG + Intronic
1119610535 14:76058018-76058040 ACAGATTGGTGGGCCTGGCAGGG - Intronic
1123813552 15:23953939-23953961 TAAGATTTGTGGGCCAGGCACGG + Intergenic
1124464900 15:29928651-29928673 ACACACTTGTCGGCCGGGCACGG + Intronic
1125020069 15:34975748-34975770 TCAGAAATGTGGGCCGGGCATGG + Intergenic
1126081589 15:44968510-44968532 TAAGATTTTTCGGCCAGGCACGG - Intronic
1126791218 15:52222871-52222893 TGAGATTTGAAGGCCGGGCACGG + Intronic
1127903164 15:63356100-63356122 TAAAAATTGTCGGCCGGGCACGG + Intronic
1128186788 15:65649386-65649408 TCAGATTTTTAGGCTGGGCACGG - Intronic
1128835191 15:70803800-70803822 TCAGAGTGGTAGGCCAGGCACGG - Intergenic
1129454265 15:75668116-75668138 TAAGAATGGTCGGCCTGGCATGG + Intergenic
1134385364 16:13766867-13766889 GCAGATTTTTGGGCCAGGCACGG - Intergenic
1135047128 16:19165187-19165209 TCAAATGTGTCTGCCCTGCAGGG - Intronic
1139448694 16:67014138-67014160 CCAGCGCTGTCGGCCCGGCAGGG - Intergenic
1140680924 16:77383829-77383851 TCAGCTTTTTGGGCCAGGCACGG - Intronic
1143384392 17:6519045-6519067 TAAGATTTGTAGGCCGGGCATGG + Intronic
1144514891 17:15910587-15910609 ACATATTTGTAGGCCGGGCACGG - Intergenic
1146627972 17:34448358-34448380 TCAGATTCGTTGGCCTGGAATGG - Intergenic
1148603845 17:48913641-48913663 ACAGATTTCTGGGCCGGGCACGG - Intronic
1151307112 17:73270149-73270171 TTACATTTGTGGGCCAGGCATGG + Intergenic
1151921119 17:77156282-77156304 ATAGATTTCTCGGCCAGGCACGG + Intronic
1152537055 17:80957029-80957051 TCAGAATTGTCGCCCCAGCCTGG + Intronic
1152537064 17:80957068-80957090 TCAGAATTGTCACCCCGGCCTGG + Intronic
1152537135 17:80957380-80957402 TCAGAATTGTCATCCCGGCCCGG + Intronic
1154382575 18:13865901-13865923 TCAGATTTGTTGGCCAGGCACGG - Intergenic
1161263920 19:3354190-3354212 AAAGATTTGTAGGCCAGGCATGG - Intergenic
1162207754 19:9068707-9068729 TCAAATATGTGGGCCGGGCATGG - Intergenic
1163335370 19:16667916-16667938 TCAGAATTGTGGGTCAGGCATGG + Intronic
1165328501 19:35127674-35127696 TAAGATTTATGGGCCGGGCACGG - Intronic
1165719393 19:38068317-38068339 TCTGATTTTTCGGCCGGGCGTGG - Intronic
1165918468 19:39276509-39276531 TTGGATTTGTCGGCCGGGCGTGG - Intergenic
1168659287 19:58153984-58154006 TCACATATGTTGGCCAGGCAGGG - Intronic
926228552 2:10985627-10985649 TCATATATGTAGGCCGGGCATGG + Intergenic
930128664 2:47825865-47825887 TCAGATTTGTCGGCCCGGCATGG - Intronic
931893507 2:66702576-66702598 TCAGATTTATGGGTCCAGCAAGG - Intergenic
937602974 2:123761786-123761808 AGAAATTTGTCGGCCAGGCACGG + Intergenic
939337570 2:140849828-140849850 TTAGATTTCTCGGCTGGGCACGG - Intronic
939635359 2:144575690-144575712 TCAGAGGTGTTGGCCGGGCACGG - Intergenic
945420308 2:209628074-209628096 ACATATTTTTCGGCCGGGCACGG + Intronic
1172597545 20:36160291-36160313 TCAGAAGTGTAGGCCAGGCACGG + Intronic
1172711179 20:36924866-36924888 TTAGATTTCTCGGCCGGGCACGG + Intronic
1173816440 20:45992326-45992348 TCAAATTTCTCAGCCGGGCATGG + Intergenic
1174228471 20:49024261-49024283 TCTGATATGTAGGCCAGGCATGG - Intronic
1174921082 20:54702574-54702596 TAAGATTTGTCGGCCGGTCGCGG - Intergenic
1177705313 21:24696557-24696579 TCACATATGTTGGCCGGGCATGG - Intergenic
1180899869 22:19362849-19362871 TCAGTTTTCTCAGCCAGGCATGG - Intronic
1180987189 22:19911935-19911957 TCAGGTGTGTCTGCGCGGCAGGG + Intronic
1182433309 22:30313689-30313711 ACACATTTGTTGGCCAGGCACGG - Intronic
1183800095 22:40155575-40155597 GCAGTTTTGTCAGCCAGGCAGGG - Intronic
1203292564 22_KI270736v1_random:9581-9603 TTAGATTTGTGGACCCAGCATGG + Intergenic
951589975 3:24254071-24254093 TCAGATTTACCGGCCGGGCGTGG + Intronic
952442291 3:33343028-33343050 TTATATTTGTTGGCCGGGCACGG - Intronic
955226820 3:57067159-57067181 TAACATTTGTCGGCCAGGCGCGG + Intronic
957548013 3:81665241-81665263 TGAGATTTGTTGGCCGGGCGTGG + Intronic
959592418 3:108094616-108094638 TCACATATGTTGGCCAGGCACGG - Intergenic
960493281 3:118344701-118344723 TAAGATTTCTTGGCCAGGCACGG + Intergenic
962075900 3:132081343-132081365 TAAGATTTGTCGGCCGGGCGCGG - Intronic
962585950 3:136843031-136843053 TCAGAGTTCTGGGCCAGGCATGG + Intronic
964573779 3:158141805-158141827 TAAGATTTCTCGGCCAGGCGTGG + Intronic
968226639 3:196976568-196976590 TAAGTTTTGTGGGCCGGGCATGG - Intergenic
969367050 4:6702009-6702031 TCAGAATTGTTGGCCAGGCGTGG - Intergenic
972500630 4:39674883-39674905 TAAGATTTGACGGCCAGGCGCGG + Intergenic
976597332 4:86906435-86906457 TCAGCTTTTTAGGCCAGGCATGG + Intronic
985867029 5:2521982-2522004 TCACACTTGTCGGCTGGGCATGG - Intergenic
987304374 5:16623880-16623902 TCATAATTGACGGCCGGGCACGG - Intergenic
987749261 5:22018779-22018801 TCAGAAATGTTGGCCAGGCACGG + Intronic
988386984 5:30577317-30577339 TCAAATATCTCGGCCGGGCACGG - Intergenic
988526496 5:31991736-31991758 TGACAATTGTGGGCCCGGCACGG + Intronic
989981169 5:50647644-50647666 TAACATTTGTAGGCCGGGCATGG - Intergenic
992436193 5:76758161-76758183 TCAGAATTTTCAGCCGGGCATGG - Intergenic
992696222 5:79290695-79290717 TTAGAAATGTCGGCCGGGCACGG + Intronic
996720823 5:126628468-126628490 AAAAATTTATCGGCCCGGCATGG + Intergenic
999914180 5:156239107-156239129 TCAGATTTGGAGGCTGGGCATGG + Intronic
1000700506 5:164443536-164443558 ACAGATATGTCGGCCGGGCGCGG - Intergenic
1003228020 6:4223873-4223895 TAAGATTTGACTGCCCTGCATGG + Intergenic
1003858005 6:10295389-10295411 TCATACATGTCGGCCAGGCACGG - Intergenic
1004666493 6:17752762-17752784 TCAGCTTTCTTGGCCAGGCACGG - Intergenic
1008047917 6:46870448-46870470 TAAGATTTTTAGGCCAGGCATGG - Intronic
1011448857 6:87472342-87472364 TCAGATGTATCGGCCGGGCGTGG - Intronic
1013078930 6:106795378-106795400 TCAGGTTTGGGGGCTCGGCATGG - Intergenic
1019885604 7:3901918-3901940 TCAGATTTGGCTGCTGGGCATGG + Intronic
1027422930 7:78034816-78034838 TGAGATATTTCGGCCGGGCACGG - Intronic
1028791477 7:94858149-94858171 TCATACTTGTAGGCCAGGCACGG - Intergenic
1029293064 7:99517388-99517410 ACAAATTTGTGGGCCAGGCATGG + Intronic
1030051484 7:105541485-105541507 TAAGTTTTCTCGGCCTGGCACGG + Intronic
1030983069 7:116209728-116209750 TCAGATTGGTCGGTCTGGAAGGG - Intergenic
1034059825 7:148076731-148076753 TCAGAGCTATCGGCCGGGCACGG - Intronic
1038010166 8:23469292-23469314 GCAGATGTGTTGGCCGGGCATGG - Intergenic
1039265880 8:35823375-35823397 TAAGATTTGTTGGCTGGGCATGG + Intergenic
1044136188 8:88588896-88588918 TGACATTTGTGGGCCGGGCATGG + Intergenic
1044999989 8:97870226-97870248 TGAGATATGGCGGCCGGGCACGG + Intronic
1047239676 8:123074308-123074330 ACTGATTTGTCGGCCAGGCGCGG - Intronic
1048011653 8:130461910-130461932 TTAGATTTATAGGCCGGGCATGG - Intergenic
1048353934 8:133638233-133638255 TAAGATTTTTAGGCCGGGCATGG + Intergenic
1051081216 9:13296046-13296068 TAATGTTTGTCGGCCCGGCGTGG + Intergenic
1057894789 9:98900387-98900409 TCAAATTTTTAGGCCAGGCACGG - Intergenic
1058065575 9:100544865-100544887 TAAGATTTGACTGCCCTGCATGG - Intronic
1058210898 9:102168565-102168587 ACATATTTGTAGGCCGGGCATGG - Intergenic
1061109686 9:128560023-128560045 TCAAAATTATCGGCCAGGCAGGG - Intronic
1062460201 9:136659783-136659805 TCAGAGGTGGAGGCCCGGCAGGG - Intronic
1188088148 X:25928301-25928323 TAAGATGTGTAGGCCCGGCGCGG - Intergenic
1190818318 X:53948731-53948753 TAAAAATTGTCGGCCGGGCACGG + Intronic
1191887117 X:65900128-65900150 TCTGATTTTTGGGCCAGGCATGG + Intergenic
1192401204 X:70838126-70838148 ACACATTTGTTGGCCAGGCACGG + Intronic
1196430878 X:115623937-115623959 GCACACTTGTCGGCCGGGCACGG + Intronic
1197455641 X:126673896-126673918 TCAGATGGGGCGGCCGGGCAGGG - Intergenic
1198428565 X:136543487-136543509 TGAGATTTGTAGGCCAGGCATGG + Intronic
1199055652 X:143290801-143290823 TCCAATTTGTAGGCCGGGCATGG - Intergenic