ID: 930131757

View in Genome Browser
Species Human (GRCh38)
Location 2:47859116-47859138
Sequence ACATTTACTTCAACTCTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 304}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930131757 Original CRISPR ACATTTACTTCAACTCTTAA TGG Intronic
902165348 1:14566415-14566437 ACATTTAGCACAATTCTTAAGGG + Intergenic
902193829 1:14783240-14783262 ACATTTAGTTTTAATCTTAAAGG + Intronic
906536886 1:46555930-46555952 TCAGTTTCTTCAACTCTAAATGG - Intergenic
907971792 1:59390269-59390291 ACAGTTACTTAAACACATAAGGG + Intronic
908036940 1:60065690-60065712 CCATTAACTTTAACACTTAAAGG + Intronic
908104654 1:60828917-60828939 ACAGTTTCTTCACCTCTTCACGG - Intergenic
908887398 1:68805126-68805148 ACCTTTACCTCTACTCTTTATGG - Intergenic
909138963 1:71838854-71838876 AATTTTACTTCAACTTTTATTGG - Intronic
909317149 1:74237466-74237488 AGATTTTCCTCAACTTTTAAAGG + Intronic
909912104 1:81273453-81273475 ATGTTTTCTTAAACTCTTAATGG - Intergenic
910471499 1:87558071-87558093 ACATTTTTTTCAGCTCTTATTGG + Intergenic
910858170 1:91717159-91717181 AAACTTTCTACAACTCTTAAAGG - Intronic
910858176 1:91717226-91717248 AAACTTTCTACAACTCTTAAAGG - Intronic
911925858 1:103831882-103831904 ACATTTACTTTAAATTTAAATGG - Intergenic
912005102 1:104889475-104889497 ACATAAACATCAACTCATAATGG + Intergenic
912139924 1:106711952-106711974 ACATTTTCTTCAACCATTGATGG - Intergenic
912280786 1:108310666-108310688 CAAGTTACTTTAACTCTTAAAGG - Intergenic
916259796 1:162829920-162829942 TCTTTTACTTCAAATCTAAAGGG + Intronic
916847137 1:168663009-168663031 ACATTTACCATAATTCTTAAGGG - Intergenic
917143977 1:171868080-171868102 ACATTGAGTCCAACTCTTTATGG + Intronic
917861521 1:179149653-179149675 AGATTTAGTGTAACTCTTAAAGG - Intronic
918011340 1:180589843-180589865 ACTTTTACTTGAAATCTGAAAGG - Intergenic
918471500 1:184880390-184880412 TCATTTACTTAAAATCCTAATGG + Intronic
918733482 1:188028606-188028628 ATATTTCCTTCATTTCTTAATGG + Intergenic
918809450 1:189096678-189096700 ACATTTATTTTAATTCTAAAAGG - Intergenic
919005115 1:191889125-191889147 CCATTTACTTACTCTCTTAATGG - Intergenic
919477069 1:198042165-198042187 ACATGGACTTCACCTCTTGATGG - Intergenic
920304798 1:205011713-205011735 ACATGCTCTTCAACTCTCAACGG + Intronic
921345338 1:214178014-214178036 ACATGTACTTGAACACTTGAGGG - Intergenic
921542619 1:216434763-216434785 ACATTTTCTTCCAGTCTTTATGG + Intergenic
921642019 1:217566706-217566728 ACATTTAAATTAACACTTAAAGG + Intronic
923862732 1:237907951-237907973 AAATTACCTTCATCTCTTAATGG - Intergenic
924226517 1:241926609-241926631 ACTTTCTTTTCAACTCTTAATGG - Intergenic
924316292 1:242801086-242801108 TCATTTCCTTCTACTCTTGAGGG - Intergenic
1063261865 10:4398101-4398123 ACATTTTCTTCAAATCATATGGG - Intergenic
1063304416 10:4883763-4883785 ACATTACCTTGAACTCTAAAGGG - Intergenic
1064319423 10:14289002-14289024 ACATTTTCTTCATCTTTAAATGG + Intronic
1064524361 10:16238621-16238643 ACTTTTACTTCAACCCAAAATGG + Intergenic
1069216222 10:65824746-65824768 GCATTTTCTTAAACACTTAAAGG + Intergenic
1069237082 10:66089578-66089600 ACAGTAACTTCAAATCATAAGGG - Intronic
1069836538 10:71312782-71312804 ACATAGACTTCAACTCTTGATGG - Intergenic
1071275881 10:84054628-84054650 ACATACACTTCACCTCTTGATGG - Intergenic
1074519932 10:114210275-114210297 ACATTTTCTTGAACTCTTTTAGG + Intronic
1080309562 11:30874004-30874026 ACATTTCCATCATTTCTTAAGGG + Intronic
1080375311 11:31702893-31702915 ATATTTACTTCAAATTTTATTGG + Intronic
1082716600 11:56621390-56621412 ACATTTTCTTCATCTTTCAATGG - Intergenic
1082989398 11:59194424-59194446 TCATTTACTCCAGCTCTTAGTGG + Intronic
1084754555 11:71228224-71228246 TCATTTCCTACAACTATTAAGGG + Intronic
1085983578 11:81756126-81756148 ACTTTTACTTAAACTCAGAATGG - Intergenic
1087936979 11:104045741-104045763 ACATTTATTTCAAGTTTTCATGG + Intronic
1087985867 11:104678640-104678662 GCATTTAATTTAAATCTTAAAGG + Intergenic
1091348037 11:134868447-134868469 ACATTTACTTGTGCTCTTCAGGG - Intergenic
1092716456 12:11394029-11394051 AAATTTACTGCAACTATTCAGGG - Intronic
1092825190 12:12392238-12392260 ACATTTTCCTCATCTCTAAAAGG - Intronic
1093109109 12:15127896-15127918 ACATTAATTTCTACTTTTAAGGG - Intronic
1093179853 12:15954471-15954493 ACATTTGAATCGACTCTTAAAGG + Intronic
1093636551 12:21478003-21478025 TAATTTACTCTAACTCTTAAAGG - Intronic
1093812256 12:23505244-23505266 AAACTGACTTCAACTCTTCAGGG + Intergenic
1093883818 12:24436888-24436910 AGATTTACTCCAATTCTTAAGGG - Intergenic
1094210661 12:27886785-27886807 ACATATACTTAAAATTTTAAAGG + Intergenic
1094433695 12:30398150-30398172 AAATTTATTTCAATTTTTAAGGG + Intergenic
1095189594 12:39241525-39241547 ACATTTAGCTCAATTATTAATGG - Intergenic
1095384525 12:41634964-41634986 AGATATTCTTCAAGTCTTAAAGG + Intergenic
1097600012 12:61679718-61679740 ACATTTCCTTCCACACTCAATGG + Intergenic
1099082119 12:78197553-78197575 ACATTTACTTCAAAACATCATGG - Intronic
1099695848 12:86018125-86018147 TCTTTTCCTTCAACTCTTCAGGG + Intronic
1099813628 12:87618387-87618409 ACATGTACTTCCACTCATCAAGG - Intergenic
1100570022 12:95838589-95838611 ACATTTCCACCACCTCTTAAAGG + Intergenic
1101310103 12:103570481-103570503 ACATTTTCTTTAACTGTTGATGG - Intergenic
1101359542 12:104013443-104013465 ACATGTACATCAACTCGTGAGGG - Intronic
1103175189 12:118857376-118857398 ACATTTTCTTCATCTGTTGATGG + Intergenic
1104430151 12:128709705-128709727 ACATTTTCATCATCTCTAAAAGG + Intergenic
1106819947 13:33453576-33453598 TCATATACTTCATCTCTTATTGG - Intergenic
1107507739 13:41051502-41051524 ACATTTAATTCAACTTTTCAAGG - Intronic
1108421322 13:50252735-50252757 TCAATTACTTCAACATTTAAAGG + Intronic
1109526797 13:63586253-63586275 ACGTTTACATCACCTCCTAAAGG - Intergenic
1109844546 13:67969662-67969684 ACATTTACTTTAACTTTATAAGG + Intergenic
1110000892 13:70198380-70198402 ACATTTATTTTAACTATCAATGG - Intergenic
1110581857 13:77139056-77139078 ACAATTTCTTGAATTCTTAAGGG - Intronic
1111025471 13:82515178-82515200 ACATTTTCTTAAACTTTAAAGGG + Intergenic
1112230999 13:97589293-97589315 ACATTGACTTCCACTCATCAAGG - Intergenic
1114943272 14:27643667-27643689 AGATTTACTGTAATTCTTAAGGG + Intergenic
1115197138 14:30813302-30813324 ACATTTGCTTCAATTCTTGCTGG - Intergenic
1115902849 14:38173251-38173273 ATATTTAATCCAACTATTAATGG + Intergenic
1116091675 14:40315650-40315672 CCTTTTACTTGAACACTTAAAGG - Intergenic
1116251132 14:42483364-42483386 ACAATTCCTACAACTCTTAGAGG - Intergenic
1117484568 14:56181386-56181408 ACATTTACTGGCATTCTTAAGGG - Intronic
1117851419 14:59974949-59974971 ATATTTAATTCAACTTTTCAGGG + Intronic
1118499183 14:66341994-66342016 ATATTTATTTCCACTCTTTATGG - Intergenic
1120523820 14:85554835-85554857 ACCTTTGAGTCAACTCTTAATGG - Intronic
1123695005 15:22872580-22872602 AGATTTACTTCCAGTCTTACAGG - Intronic
1125252698 15:37724064-37724086 AGATTTAATGCAATTCTTAAGGG + Intergenic
1125340471 15:38670580-38670602 AAATTTATGTCAACTCTCAATGG + Intergenic
1126306271 15:47261615-47261637 ACATTTTCATCACCTCCTAAAGG + Intronic
1127671031 15:61195287-61195309 AGAGTTACTGCAACCCTTAATGG - Intronic
1127705197 15:61540024-61540046 CCTTTTACTTCAACACTTAGAGG + Intergenic
1127710761 15:61595463-61595485 AAATTGACTTCATCTCTGAAAGG + Intergenic
1129907496 15:79198861-79198883 ACATGGACTCCACCTCTTAATGG + Intergenic
1132028830 15:98424235-98424257 ACACTTACTTCTACTCTTTTCGG + Intergenic
1133491891 16:6278147-6278169 ACATTTACTGCCCCTCTTTATGG - Intronic
1137667044 16:50256925-50256947 ACATTTTCTTCATCCATTAATGG - Intronic
1138971802 16:62153494-62153516 ACTTTTTCTTCATCTATTAAGGG + Intergenic
1140137753 16:72222868-72222890 ACATTTAAGTTGACTCTTAAAGG + Intergenic
1141528072 16:84626046-84626068 ACATTTTCTTCAACCCCTGAAGG - Intergenic
1142794037 17:2293016-2293038 ACACTAACTTCAACCCTCAAAGG + Intronic
1142919001 17:3168089-3168111 TCCTTCACTTCAACACTTAAAGG + Intergenic
1155220439 18:23680430-23680452 CCATTTACTCCACCTCTTCAGGG + Intergenic
1157010227 18:43639319-43639341 TCATTTACTTGAACACTTAGAGG + Intergenic
1157743404 18:50113668-50113690 ACACTAACTTCAACCCTTCAGGG - Intronic
1157791385 18:50534412-50534434 ACATTCACTGGAACTCTCAATGG + Intergenic
1159381903 18:67670927-67670949 ACATTCAGTTCAACCTTTAAGGG - Intergenic
1160090295 18:75820550-75820572 AAATTTACAACAAATCTTAAAGG - Intergenic
1164422012 19:28102348-28102370 ACATTTATTTCATGTCTGAAAGG - Intergenic
1166002125 19:39883772-39883794 GCAGTTACTTCACCTCTTTATGG + Intronic
1166004909 19:39900023-39900045 GCAGTTACTTCACCTCTTTATGG + Intronic
1167815888 19:51880690-51880712 CCATTTCGTTCAACTCTTAGGGG + Exonic
925318495 2:2942808-2942830 ACATTTAATTAAACTCTGCAGGG - Intergenic
925999848 2:9321852-9321874 ACAATTACTTCAAGTTTAAAGGG - Intronic
926810272 2:16749803-16749825 ACATTGACTTCCACTCATTAAGG - Intergenic
928535556 2:32236911-32236933 ACAATTACATTAAATCTTAATGG + Intronic
928801854 2:35103752-35103774 CCATTTTCTTCAATTCTTGAGGG - Intergenic
930114039 2:47703555-47703577 ATATTTGCTTCAACGCTTCAGGG + Intronic
930131757 2:47859116-47859138 ACATTTACTTCAACTCTTAATGG + Intronic
930352127 2:50270074-50270096 AAATTTCCTTCAACACATAATGG - Intronic
930577434 2:53168503-53168525 ACAATTACTTCAACTCCAACTGG + Intergenic
931681776 2:64755838-64755860 AAATTTACTTAACCTCATAAAGG + Intergenic
932251800 2:70251175-70251197 ACATTTTCTTCACCTCAAAAAGG + Intergenic
932555737 2:72823961-72823983 CCATTTTCTTCAGCTCTTAAGGG - Intronic
932909749 2:75792981-75793003 AAATAGACTTCATCTCTTAATGG + Intergenic
934035499 2:88085609-88085631 CCATTTACTTCAGGTCTTGAAGG - Intronic
935366801 2:102301955-102301977 ACAATTACCACAACTCTTACAGG - Intergenic
936829534 2:116626128-116626150 ACAATTACTTCAAAACTAAAAGG + Intergenic
937745406 2:125406528-125406550 ACATTTGCTTAAACTGTAAATGG + Intergenic
938742265 2:134244112-134244134 AGATTTGCTTCCACTCTCAAAGG - Intronic
939121605 2:138124191-138124213 TCATTAACTTTTACTCTTAAAGG + Intergenic
939603116 2:144218784-144218806 ACATTTATTTCATCTCATCAAGG - Intronic
940175438 2:150872716-150872738 TCATTTACTTCCATGCTTAAGGG + Intergenic
940307797 2:152245197-152245219 AAATTTACTCCAACACCTAATGG - Intergenic
940350211 2:152676305-152676327 AAATTTATTTAAACTATTAATGG + Intronic
940465652 2:154023686-154023708 ACATTAACTTTAAATCTAAATGG - Intronic
941219467 2:162757992-162758014 AGGTTTATATCAACTCTTAAAGG + Intronic
942263993 2:174202232-174202254 ACATTTCTTTCAACTGTGAATGG - Intronic
942539983 2:177006038-177006060 AGATTTAGTATAACTCTTAAGGG - Intergenic
942829826 2:180226362-180226384 ACATATACTTCTACTCACAAAGG - Intergenic
944720011 2:202414412-202414434 TCATTCACTTGAACACTTAAAGG - Intronic
944917315 2:204374292-204374314 ACATCTACTTCACCTCCTAGAGG - Intergenic
945575114 2:211521066-211521088 CCATTTACTTAAACACTTAGGGG - Intronic
946296567 2:218788459-218788481 ACATGGACTTCACCTCTTAATGG + Intronic
946803438 2:223445605-223445627 CCATTGACTTCAAATCTCAAGGG + Intergenic
947574268 2:231260014-231260036 ACATATATTTCAAATCTTCAGGG - Intronic
1169565853 20:6852885-6852907 ACACATACTTCACCTCTTAATGG - Intergenic
1170042538 20:12053440-12053462 ACATGGACTTCACCTCTTGATGG + Intergenic
1170299729 20:14869774-14869796 GCATTTACTTTAACTAATAATGG - Intronic
1171007850 20:21484970-21484992 ACACTTATTTCATTTCTTAAAGG - Intergenic
1171026236 20:21632921-21632943 ACATTTATTTCCCCTCTGAAGGG + Intergenic
1171033049 20:21693919-21693941 ACGTTAACATCACCTCTTAAAGG + Intergenic
1173484687 20:43432013-43432035 ACATTTCCTTCAAATCTGAAAGG + Intergenic
1174409664 20:50326538-50326560 ATATTTAATTCAATTTTTAAAGG + Intergenic
1175577464 20:60071969-60071991 ACATTTACAACATCTCTGAATGG - Exonic
1177129358 21:17237545-17237567 AAATTTCCTTCCACTCTCAAAGG - Intergenic
1177267831 21:18807572-18807594 ACATTTACTCTAAGTATTAAGGG + Intergenic
1177382842 21:20367816-20367838 ACATTTATCTCAACTGTGAATGG + Intergenic
1177644331 21:23883221-23883243 AAATGTTCTTCAACTTTTAATGG - Intergenic
1178149016 21:29772784-29772806 CCATTTTCTTCACCACTTAATGG + Intronic
1178151920 21:29804958-29804980 AGACTAACTTCACCTCTTAAAGG + Intronic
1181904517 22:26183557-26183579 ACATTTATTTCACCCATTAAAGG - Intronic
1182521386 22:30886475-30886497 ACTCTTACTTCATCTCTTCAGGG + Intronic
1182845011 22:33423288-33423310 ATATTTACTTCAACGTGTAATGG - Intronic
1182936777 22:34230349-34230371 ACATTTGCTTCAATGCTTCATGG + Intergenic
1183761737 22:39826210-39826232 ACAATTGCTTCAGCTCTAAAAGG - Intronic
1184631006 22:45779985-45780007 ACATTAACTTCAAATGTTTAAGG - Intronic
949705073 3:6807077-6807099 ACATTTAGTTCAATATTTAATGG + Intronic
951096787 3:18641640-18641662 CCTTTTACTTTAACACTTAAAGG + Intergenic
951312614 3:21147042-21147064 ACATTCAATTGAACTCTAAAGGG - Intergenic
951426087 3:22546438-22546460 AGAATTACTTCAACTTTTATTGG + Intergenic
951631851 3:24730495-24730517 GCATTCACTTCAATTTTTAAAGG - Intergenic
951851859 3:27150460-27150482 AGATTTAGTACAATTCTTAAGGG - Intronic
956082612 3:65574912-65574934 AAATTAACTTCAACTCGGAATGG + Intronic
957761860 3:84569182-84569204 ACATTTTCTTTACCTCTTGAAGG - Intergenic
958433173 3:94065918-94065940 CAAATTACTTAAACTCTTAACGG - Intronic
958633948 3:96718462-96718484 CCATTTACTTGAACACTTATTGG - Intergenic
959226157 3:103587904-103587926 AAATTTACTTCACCACTGAAAGG + Intergenic
960602274 3:119469798-119469820 TCATTTACTTCACTTTTTAAAGG + Exonic
962952655 3:140233576-140233598 ACATTTTCTTCTACTCCAAAGGG + Intronic
963052753 3:141156414-141156436 ACACTTACTTAAACTAGTAAAGG + Intergenic
963477000 3:145820080-145820102 ACATTTAATTCTACCATTAATGG + Intergenic
963957136 3:151266619-151266641 TCATTTACTTAAAATCTTCAAGG - Intronic
965668761 3:171124398-171124420 ACATTTTCCTCAAGTCTTATTGG - Intronic
965946391 3:174247232-174247254 ACATTGACTTCAACTGAAAATGG - Intronic
967213671 3:187191842-187191864 AAATAAACTTCAACTCTTGATGG - Intergenic
968352997 3:198077887-198077909 ACATATACTTCATATATTAATGG + Intergenic
968353000 3:198077974-198077996 ACATATACTTCATATATTAATGG + Intergenic
968353001 3:198078003-198078025 ACATATACTTCATATATTAATGG + Intergenic
970413195 4:15830856-15830878 ACATTTACGTCAAATGTAAATGG - Intronic
970987962 4:22179906-22179928 AAATTTATTTCAGCTCTTGAAGG - Intergenic
971435607 4:26619547-26619569 CCATTTGCTTCCACTTTTAATGG - Intronic
971545740 4:27883290-27883312 ACATTTACTAAAAATATTAATGG + Intergenic
971689599 4:29815817-29815839 ACATTTAATTCATCCATTAATGG + Intergenic
972388347 4:38589344-38589366 CAAATTACTTCAACTCTTCATGG - Intergenic
972724477 4:41734341-41734363 ACATTAATGTCAACTCTTCAAGG + Intergenic
973294595 4:48503017-48503039 ACATTTACTGCAACGATTCAGGG + Intronic
974023000 4:56708134-56708156 AAATTTACTGCAGCTCTTCAGGG - Intergenic
974673371 4:65059159-65059181 CCATCTACTTAAATTCTTAATGG - Intergenic
975035152 4:69670211-69670233 ACTCTTACTTCAACTTTCAAAGG - Intergenic
975460292 4:74644365-74644387 ACATTTCCTTAACCTGTTAAAGG + Intergenic
975760555 4:77615569-77615591 ACATTTACTACAAGTCTTTGTGG + Intergenic
976183995 4:82427907-82427929 TCATTTAATTCTACTCTTACAGG + Intronic
977253370 4:94713265-94713287 TATTTTGCTTCAACTCTTAAAGG + Intergenic
977253435 4:94713916-94713938 TATTTTGCTTCAACTCTTAAAGG + Intergenic
979145624 4:117243696-117243718 ATATTTACTTCATGTATTAAGGG + Intergenic
979503187 4:121463169-121463191 CCATTTATTTCTATTCTTAAGGG - Intergenic
979657811 4:123217227-123217249 GCATTTACTCCAGCTGTTAATGG - Intronic
979718472 4:123870100-123870122 ACATTTACTTCCAGACATAAAGG + Intergenic
979823310 4:125201318-125201340 ACATTTATATTAATTCTTAAGGG - Intergenic
980136690 4:128864990-128865012 ACATTTACTGCATCTTTTAGGGG - Intronic
981924366 4:150122040-150122062 AGATTTACTATAATTCTTAAAGG + Intronic
981955813 4:150472547-150472569 ACATTTTCTTCATCTCTTCTCGG + Intronic
982316193 4:154034463-154034485 GCATTTACGTCCTCTCTTAAGGG + Intergenic
983735243 4:171050471-171050493 ACATATCCATCACCTCTTAAAGG - Intergenic
984833051 4:183993574-183993596 TGCTTTACTTCAACACTTAATGG - Intronic
984892875 4:184509077-184509099 ACATAGACTTCACCTCTTGATGG - Intergenic
984986870 4:185339800-185339822 GCTTTCATTTCAACTCTTAATGG - Intronic
987489236 5:18555506-18555528 ACATTTATCTCAACTGTGAATGG + Intergenic
987610370 5:20195850-20195872 ACTTTTACTTAATCACTTAATGG + Intronic
989127638 5:38072605-38072627 ACATTTACTTCATCTGTAAAAGG + Intergenic
989482891 5:41952558-41952580 ACATTTACATCACCTCAAAAAGG + Intergenic
989763159 5:45045532-45045554 ACATTTCCTTCATCTTTTTAAGG - Intergenic
990826438 5:59904622-59904644 TTATTTACTTCAGATCTTAAGGG - Intronic
991215910 5:64157272-64157294 ACAATTCCTTCAACTCTTTTGGG - Intergenic
992372183 5:76154611-76154633 ACATTCACATCTACTCTTAAGGG - Intronic
992803935 5:80318502-80318524 AAATTTGCTTCCAGTCTTAAGGG - Intergenic
993638710 5:90376824-90376846 ACATTTCTTTCAACTGTGAATGG + Intergenic
994293757 5:98063970-98063992 ACATTTAATTTAATTATTAAAGG + Intergenic
994454888 5:99993272-99993294 AAATAGACTTCAACTCTTTAAGG + Intergenic
995498477 5:112775474-112775496 ACATTGATTTCAATTTTTAAAGG - Intronic
995639735 5:114241534-114241556 AAATTTAATTCACCTTTTAAAGG + Intergenic
996072420 5:119148435-119148457 TAATTTACTTCAATTCTTGAAGG - Intronic
997061174 5:130505002-130505024 AGATTTAGTTTAACTCTAAAAGG + Intergenic
999017966 5:148129059-148129081 ACATTTACATCAAGACCTAAGGG + Intronic
999535406 5:152511390-152511412 CCATTTGCTTCAAATCTCAAGGG + Intergenic
999912444 5:156218372-156218394 AAATTTACTTAAAGTCTTGAAGG + Intronic
1000312583 5:160059553-160059575 CCCTTTACTTGAACACTTAAAGG + Intronic
1000890144 5:166792139-166792161 AGTTTTACTTTAACTCTTAAAGG + Intergenic
1000926043 5:167195280-167195302 ACATTAACTTAAGCTATTAATGG - Intergenic
1003387014 6:5678308-5678330 ACATTTCCATCAACGCTTGAAGG + Intronic
1004045699 6:12020713-12020735 ACACTGACTTCCAATCTTAAAGG - Intronic
1004895773 6:20146513-20146535 ACTTCTGCTTCAACTCCTAAGGG - Intronic
1005441152 6:25870426-25870448 ACATTAAATTCACCTCATAAAGG - Intronic
1005524180 6:26629741-26629763 ACATTTATCTCAACATTTAAAGG - Intergenic
1005685643 6:28251097-28251119 ACATTTCCTTCAATTATGAATGG + Intronic
1007884351 6:45208966-45208988 ACATTTAGTATAATTCTTAAGGG - Intronic
1008038226 6:46769865-46769887 ACATTTCCTTCAACTATGAATGG + Intergenic
1009312426 6:62170979-62171001 ACAGTGACTTCAAATATTAAAGG + Intronic
1009479316 6:64136806-64136828 AGATTTAATATAACTCTTAAGGG + Intronic
1009631411 6:66205653-66205675 ACATTTTCTTCTATTGTTAATGG - Intergenic
1010818751 6:80389284-80389306 ACATTTACTTCCACTCACCAAGG + Intergenic
1011658730 6:89575853-89575875 AATTTTACTTCAACTCCTAGTGG + Intronic
1011949273 6:92944144-92944166 AAATAGACTTCATCTCTTAACGG - Intergenic
1012896634 6:104956629-104956651 ATATTTAATTCAATTCTTAGAGG - Intergenic
1014290289 6:119550604-119550626 CCATTTAATTCTCCTCTTAAGGG - Intergenic
1014424883 6:121291505-121291527 GTATATACTTAAACTCTTAAGGG - Intronic
1014681050 6:124430789-124430811 ACATATACTCCACCTCTCAATGG + Intronic
1015131257 6:129812514-129812536 AAATATACTTCAACTTTTACAGG - Intergenic
1015523791 6:134157204-134157226 ACATTTAGTTCAAATATGAATGG - Intergenic
1016629204 6:146207868-146207890 ACTTTTACAACAACTCTTCAGGG - Intronic
1020417368 7:7961290-7961312 ACATTCACTTCAAGTATTCATGG + Intronic
1020498084 7:8881864-8881886 ACATTGTCTCCAACTCTTGATGG - Intergenic
1020563237 7:9758822-9758844 ACATTTACTACATCTTTTGAGGG - Intergenic
1024179104 7:46871068-46871090 ACATTTAAGTTAACTCTTACTGG + Intergenic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1027554540 7:79647599-79647621 ACATTAACTTCAAATATTAAAGG - Intergenic
1028307462 7:89284079-89284101 ACATTTACCTCAACTGTGAATGG - Intronic
1028414129 7:90561919-90561941 ACATTTTCATCAGCTCTAAAAGG - Intronic
1028748435 7:94354613-94354635 AAAGTTACTTAAATTCTTAAAGG - Intergenic
1030823724 7:114128244-114128266 GAATTTTCTGCAACTCTTAATGG + Intronic
1030825380 7:114150124-114150146 GATTTTACTTCAATTCTTAAAGG + Intronic
1031377081 7:121040100-121040122 ACATTTTCATTAACCCTTAAAGG + Intronic
1031941625 7:127795513-127795535 AGCTTTACTTGAACTCTGAATGG + Intronic
1033869356 7:145731667-145731689 ACTTTTACATTTACTCTTAATGG + Intergenic
1034595745 7:152189779-152189801 ACATTTACTCCAAGGATTAAAGG + Intronic
1035820146 8:2582459-2582481 ACATTTTCTTCACAGCTTAATGG - Intergenic
1036652211 8:10652227-10652249 TCATTTCCTTCAACCCTGAAGGG - Intronic
1038068462 8:23987452-23987474 ATGCTTCCTTCAACTCTTAAGGG + Intergenic
1038468254 8:27786880-27786902 TTATTTACTTCTACTCTTTAGGG + Intronic
1040733646 8:50479923-50479945 ACATTTACTGAACCTCTTCAAGG - Intronic
1041432368 8:57797211-57797233 AGATTTAGTTTAATTCTTAAGGG - Intergenic
1041969779 8:63726818-63726840 ACATTTATTTTCACTCTTATTGG - Intergenic
1042316099 8:67427581-67427603 ACTTTTACATCATCTTTTAAGGG + Intronic
1043071915 8:75647732-75647754 ACATTCCCTTGAACACTTAAGGG + Intergenic
1043263844 8:78237505-78237527 ACTTTTGCTTTAACTCTAAAAGG - Intergenic
1044028575 8:87205537-87205559 AAATATACTTTAACACTTAAGGG - Intronic
1044656240 8:94551510-94551532 ACATTTAAATCAAGTCTTGAAGG - Intronic
1045593857 8:103630270-103630292 CCATTTACTTCCAGTCTTTATGG - Intronic
1046478381 8:114780070-114780092 AGATTTACCTTAACTCTTAAGGG - Intergenic
1047126426 8:121966539-121966561 ACATTTCCTTCAACTATAATAGG - Intergenic
1047431990 8:124800662-124800684 ACATTGACATCAACCATTAAAGG + Intergenic
1047586100 8:126274920-126274942 ATATTTTCTTCACCTCTTGAGGG + Intergenic
1048608843 8:135999935-135999957 ACTTTTACTCCCACTCCTAAAGG - Intergenic
1050087599 9:1982271-1982293 ACATTTTCTTCAAGTCCCAAGGG - Intergenic
1051917612 9:22226523-22226545 ATAGTTACTTCAACTTTTTATGG + Intergenic
1054842438 9:69758128-69758150 ACATTTATGGAAACTCTTAAAGG - Intronic
1055943736 9:81674227-81674249 ACATTTACTGCAAATCCCAATGG + Intronic
1057984555 9:99698630-99698652 AGATTTAGTACAATTCTTAAGGG - Intergenic
1060884974 9:127144882-127144904 ACATTTTCTTCACCTCAAAATGG - Intronic
1187250961 X:17597603-17597625 AGATTCACTTCCACTCATAATGG + Intronic
1187299675 X:18035993-18036015 AAATAGACTTCAACTGTTAATGG - Intergenic
1187672592 X:21683465-21683487 AGGTTTACTTCAAAACTTAATGG + Intergenic
1188518350 X:31011370-31011392 ACATTTCCCTCAACTTTTATGGG - Intergenic
1189201565 X:39200630-39200652 CCATTTGCTTCCTCTCTTAAAGG - Intergenic
1190896251 X:54621108-54621130 AACTTGACTTCACCTCTTAATGG - Intergenic
1192676401 X:73201514-73201536 AGATTTACTATAATTCTTAAAGG - Intergenic
1193142524 X:78042901-78042923 CCATATTCTTAAACTCTTAATGG - Intronic
1194322187 X:92461936-92461958 ACTTTTACTTAAACACTTGAAGG - Intronic
1195476192 X:105288694-105288716 AGATTTACTGCAACTTTTTAGGG - Intronic
1197771198 X:130090553-130090575 ACATTTGCTTCAGATCTTGAAGG - Intronic
1199019131 X:142854917-142854939 AAATTTATTTCAATTCTCAATGG + Intergenic
1199143767 X:144340343-144340365 ACAATTACTTCAAATGTAAATGG + Intergenic
1200630348 Y:5575413-5575435 ACTTTTACTTAAACACTTGAAGG - Intronic
1201580026 Y:15501424-15501446 ACATTTTCATCACCTCTAAATGG - Intergenic