ID: 930136334

View in Genome Browser
Species Human (GRCh38)
Location 2:47906504-47906526
Sequence GTCCCTCCCCGCCGCGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 264}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930136328_930136334 -8 Left 930136328 2:47906489-47906511 CCACTCGCCCAGTCGGTCCCTCC 0: 1
1: 0
2: 2
3: 15
4: 204
Right 930136334 2:47906504-47906526 GTCCCTCCCCGCCGCGGGGCTGG 0: 1
1: 0
2: 2
3: 29
4: 264
930136324_930136334 4 Left 930136324 2:47906477-47906499 CCGCCGGAGCCTCCACTCGCCCA 0: 1
1: 0
2: 1
3: 15
4: 155
Right 930136334 2:47906504-47906526 GTCCCTCCCCGCCGCGGGGCTGG 0: 1
1: 0
2: 2
3: 29
4: 264
930136325_930136334 1 Left 930136325 2:47906480-47906502 CCGGAGCCTCCACTCGCCCAGTC 0: 1
1: 0
2: 1
3: 20
4: 239
Right 930136334 2:47906504-47906526 GTCCCTCCCCGCCGCGGGGCTGG 0: 1
1: 0
2: 2
3: 29
4: 264
930136321_930136334 28 Left 930136321 2:47906453-47906475 CCGTGGCAGGAGGAGCCATTGAC 0: 1
1: 0
2: 1
3: 47
4: 978
Right 930136334 2:47906504-47906526 GTCCCTCCCCGCCGCGGGGCTGG 0: 1
1: 0
2: 2
3: 29
4: 264
930136323_930136334 13 Left 930136323 2:47906468-47906490 CCATTGACACCGCCGGAGCCTCC 0: 1
1: 0
2: 1
3: 4
4: 80
Right 930136334 2:47906504-47906526 GTCCCTCCCCGCCGCGGGGCTGG 0: 1
1: 0
2: 2
3: 29
4: 264
930136327_930136334 -5 Left 930136327 2:47906486-47906508 CCTCCACTCGCCCAGTCGGTCCC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 930136334 2:47906504-47906526 GTCCCTCCCCGCCGCGGGGCTGG 0: 1
1: 0
2: 2
3: 29
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930136334 Original CRISPR GTCCCTCCCCGCCGCGGGGC TGG Intergenic
900088704 1:910077-910099 TTCCCTCTCCGCGGCGCGGCCGG - Intergenic
900095981 1:940304-940326 CCCCCGCCCCGCCGCGGAGCCGG + Intronic
900125534 1:1067483-1067505 GTGGCTCCTCCCCGCGGGGCAGG + Intergenic
900143812 1:1149595-1149617 GCCCCTTCCCACCACGGGGCGGG - Intergenic
900393460 1:2443688-2443710 GCCCCCTCCCGGCGCGGGGCGGG + Intronic
900424126 1:2568342-2568364 GTTCCTCCCCGCTGCAGGCCAGG + Intergenic
900549186 1:3245528-3245550 GTCCCTCCCCGTCGCTGGTGTGG + Intronic
900562455 1:3314059-3314081 GTCCTTCCCCACCGGGGGGGGGG + Intronic
900568311 1:3346233-3346255 GTCGCTCACCGCCGTGGGGCAGG - Intronic
900589870 1:3454790-3454812 GTCCCTCCGCCCCGCGGCGCAGG + Exonic
900648144 1:3718202-3718224 GCTCCTCCCCGGGGCGGGGCGGG + Intronic
901796225 1:11681073-11681095 GTGGCTCCCCGCGGCGGGGCCGG - Exonic
902169601 1:14599158-14599180 GTCCCCCGCCGCCGAGGCGCTGG - Exonic
902501414 1:16914058-16914080 GGGCGTCCCCGCCACGGGGCGGG - Intronic
902585785 1:17438105-17438127 CTCCCTCCCGGCGGCCGGGCCGG - Intronic
902747006 1:18481111-18481133 TTCCCACCCCACCGCTGGGCTGG - Exonic
903724537 1:25431007-25431029 GTCCAGGCCCGACGCGGGGCGGG + Exonic
903724680 1:25431440-25431462 GCCCCTCCCCCCGGCGGGCCCGG - Intronic
903735440 1:25527475-25527497 GACCCTGCCCGCCGAGGGCCAGG + Intergenic
903967256 1:27098615-27098637 GCCGCTCTCCCCCGCGGGGCAGG + Intergenic
905107982 1:35575242-35575264 GCCTCTCCCCGCCGAGGGGGAGG + Intronic
907197442 1:52698178-52698200 GTCCCTCCCCGACGCGTCGCCGG + Intronic
907277845 1:53326987-53327009 CTCCCTCCCCCTCGCAGGGCCGG - Exonic
907450412 1:54542452-54542474 GCCCTTCCCCCGCGCGGGGCGGG - Intronic
907541131 1:55215816-55215838 GTGCCTCACAGCCGCGGCGCAGG - Intergenic
908523515 1:64966565-64966587 GCCCCGCCCCGCCCCGCGGCCGG + Intergenic
910773230 1:90850986-90851008 GCCCCTCCCCGCTGCCGGCCTGG - Intergenic
912568622 1:110606460-110606482 ACCCCTCCCCGCCCTGGGGCCGG - Intronic
912793449 1:112675126-112675148 GTCCCTCTGCGCCCCGGGGCGGG - Intronic
912798593 1:112707155-112707177 CGCCCTCCCCGCCGCGGCGCTGG - Intronic
913109060 1:115641854-115641876 GGCCGGCCCCGCGGCGGGGCCGG + Intergenic
913109061 1:115641856-115641878 TGCCGGCCCCGCCGCGGGGCCGG - Intergenic
913680574 1:121185151-121185173 CTTCCTCCCGGCCGCCGGGCTGG + Intronic
914032405 1:143972793-143972815 CTTCCTCCCGGCCGCCGGGCTGG + Intergenic
914157040 1:145095174-145095196 CTTCCTCCCGGCCGCCGGGCTGG - Intronic
915616867 1:157045865-157045887 TTCCCTCGCTCCCGCGGGGCGGG + Intergenic
917937561 1:179883140-179883162 TTCCTTCCCCGCTGCGGGTCAGG - Intronic
920467883 1:206203677-206203699 CTTCCTCCCGGCCGCCGGGCTGG + Intronic
922730803 1:227947993-227948015 TCCCCTCCCGGGCGCGGGGCGGG - Intergenic
922958659 1:229626170-229626192 GCCCCTCCCCGCTGCGCCGCCGG + Intergenic
924362342 1:243254917-243254939 GGCGCCGCCCGCCGCGGGGCGGG - Intronic
1062976666 10:1688587-1688609 GTCCCTCCCCGCCCCCCGCCTGG + Intronic
1062981353 10:1725517-1725539 GTCTCTTCCCGGCGCGGGGAGGG - Intronic
1063504016 10:6580174-6580196 CTCCCTCCCGGCGGCGGCGCGGG + Intronic
1064443101 10:15371047-15371069 GCTCATCTCCGCCGCGGGGCCGG + Exonic
1067479127 10:46584072-46584094 GGCCCTCCCTGCCCAGGGGCAGG - Intronic
1067615612 10:47757729-47757751 GGCCCTCCCTGCCCAGGGGCAGG + Intergenic
1069992813 10:72325478-72325500 GTCCCTCCCAGCTGCTGAGCTGG + Intergenic
1070329988 10:75409689-75409711 GTCCCGCCCCTCCGCCGCGCGGG + Intergenic
1070752691 10:78973538-78973560 GTCGGGCCCCTCCGCGGGGCGGG - Intergenic
1072336663 10:94403501-94403523 GCCCTTGCCCGCCGCGGAGCAGG + Exonic
1074815288 10:117137671-117137693 GGCCCTCCCCGCCCCGAGTCCGG - Intronic
1076395891 10:130136907-130136929 GGCCCTCCGCGCCACGGAGCGGG + Intronic
1076723774 10:132404172-132404194 TTCCCTCCTCTCCGAGGGGCTGG - Intronic
1076930425 10:133528430-133528452 GCACCTCCTCGCCGCGCGGCGGG + Intronic
1077205011 11:1337739-1337761 GTCCCTCCCCGCGGTGGCTCCGG - Intergenic
1077384545 11:2262847-2262869 GCCCCTCCCTGCCTCTGGGCTGG + Intergenic
1077459353 11:2700829-2700851 GTCCGTCCCCTCCGCGCCGCTGG + Intronic
1077630634 11:3808835-3808857 CTCCCTCCCCAGCGTGGGGCCGG + Intronic
1079035076 11:17014023-17014045 CCTCCTCCCAGCCGCGGGGCAGG + Exonic
1081677768 11:44980930-44980952 GTTCCTCCCCGAGGCGGGGAGGG - Intergenic
1082807761 11:57461139-57461161 CTCCCTCCCCGCTCCGGGCCGGG - Intronic
1083713994 11:64565353-64565375 GTCCCTCCCCAAGGCAGGGCTGG + Intronic
1083748013 11:64745777-64745799 GCCCCTCCCAGCCTTGGGGCGGG + Intergenic
1083751866 11:64765493-64765515 GGCCATCGCCGCCGCGGGGAGGG + Exonic
1083751867 11:64765495-64765517 ATCCCTCCCCGCGGCGGCGATGG - Exonic
1084161531 11:67353045-67353067 CTTCCTCCTCGTCGCGGGGCTGG + Exonic
1084165292 11:67372605-67372627 CTCCTTCCCCGCGGCGGGGGCGG + Intronic
1084174341 11:67415775-67415797 GGCTCTCCCCGGGGCGGGGCCGG - Intronic
1084416349 11:69035169-69035191 GTCTCACCCTGCCGCGCGGCTGG + Intergenic
1088893509 11:114061448-114061470 CTCCGTCCCCACCCCGGGGCGGG + Intronic
1089046103 11:115503557-115503579 GGCCGCCCCCCCCGCGGGGCCGG + Intronic
1089845053 11:121452051-121452073 GCCCCTCCCTGGCGCGGGGATGG - Intergenic
1091219361 11:133920907-133920929 GGCCCTCCAGCCCGCGGGGCTGG + Exonic
1091238561 11:134037383-134037405 CGCCCTCCCCTCCGCGGCGCAGG - Intergenic
1091303636 11:134523569-134523591 GCGCCTCCCCGCGGCCGGGCGGG - Intergenic
1091303656 11:134523631-134523653 GCGCCTCCCCGCGGCCGGGCGGG - Intergenic
1091303687 11:134523724-134523746 GCGCCTCCCCGCGGCCGGGCGGG - Intergenic
1091303708 11:134523786-134523808 GCGCCTCCCCGCGGCCGGGCGGG - Intergenic
1091303768 11:134523972-134523994 GCGCCTCCCCGCGGCCGGGCCGG - Intergenic
1091303778 11:134524003-134524025 GCGCCTCCCCGCGGCCGGGCGGG - Intergenic
1091303789 11:134524034-134524056 GCGCCTCCCCGCGGCCGGGCGGG - Intergenic
1091303799 11:134524065-134524087 GCGCCTCCCCGCGGCCGGGCGGG - Intergenic
1091303840 11:134524189-134524211 GCGCCTCCCCGCGGCCGGGCGGG - Intergenic
1091718231 12:2794918-2794940 GTCCCGCCCCGCCGCGAGGGAGG - Intergenic
1092644187 12:10551468-10551490 CTCCCTCCGAGCCACGGGGCAGG - Intergenic
1092820614 12:12350336-12350358 GTCCCTCCCCGCGGAGGCTCCGG + Exonic
1093548002 12:20369842-20369864 CTCACTCCCCGCCGCGGGGGTGG + Exonic
1100260523 12:92928879-92928901 CGCCCTCCCCGCCCCCGGGCCGG + Intronic
1102101163 12:110280576-110280598 CTCCCTCCCCCCCGCGAGGGGGG + Intergenic
1102101620 12:110282161-110282183 GTCCCTCCCTCCACCGGGGCCGG - Intronic
1102301652 12:111775858-111775880 TTCCCTCCCCGGTGGGGGGCTGG - Intronic
1105805766 13:23950911-23950933 GTCCCTGCCCGGCGTGGGGGCGG + Intergenic
1109537120 13:63737487-63737509 GGCCCCCCCCGCCGCGAGGCGGG - Intergenic
1112290791 13:98143042-98143064 GCCTCCCCCCGCCGAGGGGCCGG + Intronic
1113745707 13:112742725-112742747 GTGCCTCCCCGCAGTGTGGCTGG + Intronic
1114731146 14:24993955-24993977 GTCCCTCCCAGCTGCAGGGATGG + Intronic
1119410373 14:74426330-74426352 GCCCCGCCCCGCCCCGGAGCCGG - Intergenic
1120521852 14:85533778-85533800 GCGCCTCCCCGCAGCGGGCCGGG - Intronic
1121103389 14:91264798-91264820 TTCCCTCCCTGCGGCCGGGCTGG + Intergenic
1122293488 14:100692332-100692354 GTCCCTGCCCGGCGCCGGGCTGG + Intergenic
1122993173 14:105248546-105248568 GCCCGTACCCGCCGCGGCGCCGG - Intronic
1123710073 15:22980448-22980470 CTCCCTCCCGGCCGCGGCCCCGG + Intronic
1128160993 15:65422848-65422870 GTCCCCCCGCGCCATGGGGCTGG + Exonic
1128504473 15:68256921-68256943 GTCCCACCGCGTCGTGGGGCAGG + Intronic
1128987141 15:72230242-72230264 CTGCCTCCCGGCAGCGGGGCAGG + Intronic
1129675996 15:77632679-77632701 GGCGCGCTCCGCCGCGGGGCCGG + Intronic
1131281120 15:91022261-91022283 GTCCTTCCACCCCGCGGCGCAGG - Exonic
1132128472 15:99251595-99251617 GGGCGTCCCCGCCGGGGGGCCGG - Intronic
1132855285 16:2042208-2042230 GTCCCTGCCCGCAGCCAGGCAGG - Intronic
1132858047 16:2056249-2056271 GTGCCTCCCCTCCCCAGGGCCGG + Intronic
1132872628 16:2122542-2122564 GTCCCACCCCACGGCGGGGATGG - Intronic
1132913107 16:2325950-2325972 GTGCCTCCACGCGGCTGGGCAGG - Intronic
1132954007 16:2581424-2581446 GTCCCTCCCAGCCTCGAGGTGGG + Intronic
1132960338 16:2618739-2618761 GTCCCTCCCAGCCTCGAGGTGGG - Intergenic
1133304774 16:4802139-4802161 GTCCCGCCCGGCCTCGGGTCGGG - Intronic
1133760963 16:8797927-8797949 GACCCTCACCGCCCCGCGGCAGG + Exonic
1134551725 16:15141742-15141764 GTCCCACCCCACGGCGGGGATGG - Intergenic
1136146831 16:28320999-28321021 GAGCCACCTCGCCGCGGGGCAGG + Exonic
1136588373 16:31202237-31202259 TTCCCTTCCCGCCGTGGGGCCGG + Intronic
1137609229 16:49807866-49807888 GTCCCTGCCAGCCCCGGGGCAGG - Intronic
1138279282 16:55760793-55760815 GTCGCGCCCCGCCACGGAGCCGG - Intergenic
1139402837 16:66696267-66696289 CTCCCTCCCCGCCCCGCTGCGGG - Intronic
1140508490 16:75490061-75490083 CTCCCTCCCCGCCGAGTAGCTGG - Intronic
1141670829 16:85490972-85490994 GAGCCTCCCCAACGCGGGGCTGG + Intergenic
1142393086 16:89815746-89815768 GACCCTCCCCTCTGCGGGCCAGG + Intronic
1143016450 17:3893285-3893307 GTCCCTCCCGGCCGCGGCGTGGG + Intronic
1144621521 17:16821484-16821506 GTCCCTCCCCACAGCCAGGCAGG - Intergenic
1145147327 17:20493148-20493170 GTCCCTCCCCACAGCCAGGCAGG - Intergenic
1147573489 17:41585798-41585820 GTCCCTCCCCACAGCCAGGCGGG - Intronic
1148052301 17:44775315-44775337 CATGCTCCCCGCCGCGGGGCTGG - Intronic
1148534804 17:48430237-48430259 GCCCAGCCCGGCCGCGGGGCGGG + Intronic
1148534807 17:48430239-48430261 GCCCCGCCCCGCGGCCGGGCTGG - Intronic
1148865466 17:50626090-50626112 GGCCCTCCCCGCCCCTGGCCCGG + Exonic
1151780299 17:76240731-76240753 GTCCCGCCCCGCCCCGCCGCGGG - Intergenic
1151783831 17:76265630-76265652 GAGCCTGGCCGCCGCGGGGCCGG + Intronic
1151966972 17:77436612-77436634 GTCACTCCCTCCAGCGGGGCAGG - Intronic
1152558806 17:81067723-81067745 GTGCCTCCCCGCTGCGATGCTGG - Intronic
1152817117 17:82414624-82414646 GTCCCTCCCTGCGGCGCGGCTGG + Intronic
1152938454 17:83153719-83153741 CTCCCTCCCCCCAGCGGGGCAGG - Intergenic
1153267312 18:3284060-3284082 GCCCCTCCCCTCCACAGGGCAGG - Intergenic
1153480827 18:5544140-5544162 TGCCCTCCCAGCCGCGGGGGAGG + Exonic
1155654027 18:28175820-28175842 GCCCACCCTCGCCGCGGGGCAGG - Intronic
1156213879 18:34977144-34977166 GTCCCTCCCAGGCCAGGGGCTGG + Intronic
1160515300 18:79476200-79476222 ATCCCTCCCAGGCGCGCGGCTGG - Intronic
1160869253 19:1269529-1269551 GTCCCTCGCCGCCGGCGGGGCGG - Intronic
1161101884 19:2425523-2425545 GTCCCGCCCAGCCGCCGGGGAGG + Intronic
1161345509 19:3767106-3767128 GTCCCTCCCCGACCCTGGGCTGG - Intronic
1161450595 19:4343513-4343535 GCCCCTCCCCTCCCCGGGGCGGG + Exonic
1161593046 19:5137343-5137365 CTCGCTCCCCGCAGCGGGGGTGG + Intronic
1161706773 19:5825800-5825822 CTGCCTCCCTGCAGCGGGGCTGG - Intronic
1162567352 19:11451682-11451704 GCCCCTCCCCGCAGGGGGCCAGG - Exonic
1163018703 19:14471721-14471743 GCCCCTCACAGCCGCGGAGCAGG + Exonic
1163118356 19:15201032-15201054 GGCTCGCCCCGCCCCGGGGCCGG + Intergenic
1163305038 19:16472340-16472362 GTCCCGACCCTCCGCGGGGTGGG - Intergenic
1163426986 19:17245444-17245466 GCCCCTCCCGGCCCCGGGCCCGG - Exonic
1163497054 19:17652714-17652736 GTCCCTCCCCTCCCCAGAGCAGG + Intronic
1163548098 19:17951063-17951085 GAGGCTCCCCGCCGGGGGGCTGG + Intergenic
1164617803 19:29677183-29677205 GTCCCTCTCCCCTGCAGGGCTGG + Intergenic
1165433877 19:35786651-35786673 GTCCCTCCAGGCAGCGGGGTGGG - Intronic
1165994284 19:39833393-39833415 TGCCCTCCCCGCCGCGGGGCCGG - Exonic
1166721847 19:45001548-45001570 GTGCCTCCCGGCCGCCCGGCCGG + Exonic
1167040324 19:47019916-47019938 GCCCCTCCGCGCCGCCCGGCCGG + Exonic
1167158707 19:47754598-47754620 GGCCCTGCCCGCCACGGAGCAGG + Exonic
1167278140 19:48551289-48551311 GTGCCTCCCAGCTGTGGGGCCGG - Intergenic
1167368023 19:49064881-49064903 GTCCCTCCCCACCCGAGGGCAGG + Intronic
1167464311 19:49642199-49642221 GCCCCGCCCCGCGCCGGGGCCGG + Exonic
1167464313 19:49642201-49642223 CTCCGGCCCCGGCGCGGGGCGGG - Exonic
1167471292 19:49677661-49677683 GCCCCTCCCCGGCCGGGGGCGGG - Intronic
928511771 2:32010089-32010111 GCCCGCCGCCGCCGCGGGGCCGG + Intronic
930136334 2:47906504-47906526 GTCCCTCCCCGCCGCGGGGCTGG + Intergenic
932702793 2:74002667-74002689 TCCCCTCCCCGCCGCGGGGCTGG - Intronic
934579536 2:95427340-95427362 GCCCCTCCGCCCCGCAGGGCTGG - Intergenic
934599908 2:95649385-95649407 GCCCCTCCGCCCCGCAGGGCTGG + Intergenic
935130970 2:100260743-100260765 GTCCCTCCCCACGGCCAGGCGGG - Intergenic
936533251 2:113291389-113291411 GCCCCTCCGCCCCGCAGGGCTGG + Intergenic
938555026 2:132416512-132416534 GTCAAACCCCGCCGCTGGGCTGG + Intergenic
943645890 2:190408059-190408081 GTCCCTCCGGGCCGCCGGGGCGG + Intergenic
944539630 2:200743244-200743266 GTCCCTCCCTGCTGCTGGGCCGG - Intergenic
944553264 2:200864714-200864736 GCGCGTCTCCGCCGCGGGGCGGG + Intronic
946172800 2:217905502-217905524 GGCCCTCCCCACCGTGGGTCAGG + Intronic
946250135 2:218406540-218406562 GTGCCTCCCGGACGCGGGGCGGG - Intergenic
948991745 2:241559098-241559120 GGCCCTCCCCGCCCCGGCCCGGG - Intronic
1169113090 20:3045834-3045856 GTTACTCCCGCCCGCGGGGCCGG - Intergenic
1173243417 20:41317567-41317589 CTCCCTCCCCGCGGCCGGGCGGG + Intronic
1173254061 20:41380922-41380944 ATCCCTCCCTGCCCCGAGGCTGG - Intergenic
1176087226 20:63303694-63303716 GTCACTCCCTGGCGCGGGGCTGG + Intronic
1176373254 21:6075053-6075075 GTCCCTCCCCGAGACGGGGAGGG + Intergenic
1176549147 21:8214011-8214033 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1176557040 21:8258232-8258254 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1176568079 21:8397049-8397071 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1176575982 21:8441269-8441291 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1177010895 21:15729836-15729858 GACCCTCCGGGCGGCGGGGCGGG - Intergenic
1178436818 21:32567317-32567339 GTGCCTCCCCTCCACAGGGCAGG - Intergenic
1179750223 21:43463190-43463212 GTCCCTCCCCGAGACGGGGAGGG - Intergenic
1179908701 21:44436986-44437008 GGCCAGCCCCGCCGCGGCGCAGG + Intronic
1180083676 21:45497977-45497999 CCCCCTCCCCTCCACGGGGCCGG + Intronic
1180189219 21:46154683-46154705 GTCCCTCCCCTGCTCGGGGGTGG - Intronic
1181026890 22:20131905-20131927 ATCCCTCCCCGGGGCCGGGCGGG - Intronic
1181274144 22:21677892-21677914 CTCCCTCCCTGCAGCGGGTCAGG - Intronic
1181670537 22:24423822-24423844 GTTTCTCCGCGCAGCGGGGCGGG + Intronic
1183220012 22:36506456-36506478 GTGTCTCCCAGCCGCCGGGCCGG - Intronic
1183222952 22:36528940-36528962 GTCCCTCCGCTGGGCGGGGCAGG - Intronic
1183244733 22:36685178-36685200 GTCTCTCCCAGCCTGGGGGCGGG + Intronic
1183978964 22:41528619-41528641 GTGCCTCCCCGCCCCGCCGCTGG + Exonic
1184086834 22:42270466-42270488 GGCCCGCCCCGCCGCCGGCCCGG - Intronic
1184796776 22:46737733-46737755 GTCCCACCTCCCCGCGGGGATGG + Intronic
1185044919 22:48523983-48524005 GTCCCAACCTGCCCCGGGGCCGG + Intronic
1185237774 22:49724824-49724846 CTCCCTCCCCGCTGCGAGGTGGG - Intergenic
1185248321 22:49785319-49785341 GGCCCTGCCGGCCGTGGGGCTGG - Intronic
1185296842 22:50058686-50058708 GCCCTTCCCCGACGCGAGGCTGG + Intergenic
1185368212 22:50446565-50446587 TTCCCTCCACGCCTCAGGGCTGG - Exonic
1185383459 22:50521053-50521075 ATCCCTCCCTGCCGGGGGTCAGG - Intronic
1203254032 22_KI270733v1_random:130327-130349 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1203262088 22_KI270733v1_random:175406-175428 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
950273985 3:11642919-11642941 GTCCCTCTCCCGCGTGGGGCCGG - Intronic
951717359 3:25664168-25664190 TTCCGCCCCCGCCGCGGGCCCGG + Intronic
953927068 3:46987956-46987978 GTCTCCTCCCGCCCCGGGGCTGG - Intronic
959067820 3:101676338-101676360 GCCCCTCCCCGCGGCTGGCCCGG + Intronic
968132433 3:196199312-196199334 CTCCCTCTCCGCCACAGGGCAGG + Intronic
968512475 4:1001729-1001751 GGGCCTCCCAGCCGCAGGGCGGG - Exonic
968967557 4:3776805-3776827 GTGCCTCCCTGCTGAGGGGCAGG - Intergenic
969112388 4:4852070-4852092 GTCCTTCCCCACCCCGGGGTGGG - Intergenic
969321807 4:6417156-6417178 CCCCCTCCCCGCCCAGGGGCTGG - Intronic
969517173 4:7654313-7654335 GACCCTCCCCATCCCGGGGCTGG + Intronic
969660079 4:8522256-8522278 CTCCCTCCCCGCCGAAAGGCAGG - Intergenic
971231024 4:24800253-24800275 GTCCCTGGCCGCCGCCGGGTGGG - Exonic
971257966 4:25031008-25031030 GGCCCCCTCCCCCGCGGGGCGGG - Intergenic
972624767 4:40785969-40785991 GTCTCTCCCAGCCGCTGGGGAGG - Intronic
974016844 4:56656002-56656024 GTCCCTGCGCGCTGCGGGGCAGG + Exonic
976830288 4:89307624-89307646 GCCCCGCCGCGCCGCGGAGCCGG - Exonic
981169570 4:141605645-141605667 GCCCCTCACTGCCCCGGGGCCGG + Intergenic
982198502 4:152937660-152937682 TTCTCTCCCCGCCGCAGAGCTGG + Intronic
983533416 4:168833065-168833087 GGCCGGCCCCGCCCCGGGGCTGG + Intronic
985995769 5:3596135-3596157 GTACCTGAGCGCCGCGGGGCCGG + Exonic
988509693 5:31854891-31854913 CTCCCTCCGCGCCGCGGTGGAGG - Intronic
988577761 5:32444022-32444044 GCCGCTCCCCGCCGCGGGCCGGG + Intronic
990456617 5:55994989-55995011 GCCCCGCCCCGCCGCGGGACTGG - Exonic
996056539 5:118988654-118988676 GTCCCACCCTGCCGCTGGGAAGG + Intergenic
998239291 5:140427387-140427409 CTCCCTCCCCGACGGGCGGCTGG + Intronic
999326936 5:150649594-150649616 CTCCTCCGCCGCCGCGGGGCTGG - Exonic
1001281445 5:170389161-170389183 CTCCCTCCCTGCCCCGTGGCAGG + Intronic
1001436342 5:171702561-171702583 TTCCTTCCCCACCCCGGGGCAGG - Intergenic
1002105952 5:176879535-176879557 CACCCACCCCGCCGCCGGGCAGG - Intronic
1002427477 5:179184830-179184852 GTCCCTCTCCGCCTCCTGGCAGG - Intronic
1002524250 5:179806689-179806711 GCCCCTCCCCGACCCGGGGCCGG - Intronic
1003290747 6:4776497-4776519 ATCGCGCCCCGCCGCGGGGCCGG - Exonic
1005931695 6:30489646-30489668 GTCCTTCGCCCCCGCCGGGCCGG - Intronic
1006945002 6:37779111-37779133 CTCCCTCCCTGCCCCAGGGCTGG + Intergenic
1008109559 6:47477922-47477944 GTCCCTCCCCACTGCGGGAGCGG + Exonic
1011607194 6:89117484-89117506 GTCGCTCCCCGCCGGGAGTCGGG - Intronic
1012471384 6:99576314-99576336 GTCCCTGCCCGACCAGGGGCAGG + Intergenic
1013836531 6:114342155-114342177 GCCCCTCCCCCGCGCGAGGCGGG + Intronic
1014230342 6:118895188-118895210 GCCCCTCCGCGCCGCGGGCTGGG + Intronic
1015244566 6:131062686-131062708 CTCCATCCCCCCCGCGGGGAGGG - Intronic
1015935684 6:138404357-138404379 GTCCCTCCTCCCGGCCGGGCTGG - Exonic
1016272249 6:142302207-142302229 GTCCCGCCGCGGCGCAGGGCTGG + Exonic
1016462019 6:144287018-144287040 GACCCTCCCGGCCGCCCGGCCGG + Intronic
1016713884 6:147203096-147203118 GCTCCTCCCCGGCGAGGGGCTGG + Intergenic
1016993887 6:149947528-149947550 GTCCCGCCCCTCCCCGTGGCTGG + Intronic
1017004446 6:150020009-150020031 GTCCCGCCCCTCCCCGTGGCTGG - Intronic
1017027904 6:150197665-150197687 GTCCCTGCCCGCCACGGTGGAGG + Intronic
1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG + Intronic
1019765187 7:2844450-2844472 ATCCCTTCCGGCCTCGGGGCGGG + Intergenic
1020100724 7:5393030-5393052 GTCCCTCCCCCGGGCAGGGCTGG + Intronic
1020261204 7:6531586-6531608 GTCCCTCCCGACCCCGGGGAGGG - Intronic
1020796841 7:12686987-12687009 GTCTCTCCCAGCCGCTGGGGAGG - Intronic
1026013506 7:66654722-66654744 GTCCGTGCCCTCCGCGCGGCTGG + Intronic
1028622236 7:92836785-92836807 GACCCACCCCCCGGCGGGGCTGG + Intergenic
1029456640 7:100675238-100675260 GCACCTCCGCGCCTCGGGGCCGG + Intronic
1029683036 7:102125457-102125479 GTCCCTGGCCGCCGCTGGGAGGG + Intronic
1034680694 7:152925486-152925508 GTCCCTCCCCCGCGCGCGCCCGG - Intergenic
1035041351 7:155930212-155930234 GCACCTCCCAGCCGCGGTGCCGG + Intergenic
1035741290 8:1930247-1930269 GTCGCTCCCGGCCGTGGGGAGGG - Intronic
1036645946 8:10611518-10611540 GTCCCACCCCGCCCAGGGGGCGG - Exonic
1036701248 8:11015480-11015502 GTCCCTCCCCGAGGTGGGGGTGG - Intronic
1040581836 8:48704632-48704654 CTCCCTCCCGGCCGCAGGCCAGG + Intergenic
1041059549 8:54022494-54022516 GTCCCGCCCCCTCACGGGGCGGG + Exonic
1045265266 8:100613514-100613536 ATCACTCCCCGCCGCTTGGCTGG + Intronic
1049730491 8:144175227-144175249 GCCCCTCCCAGCAGCGGGTCCGG + Intronic
1051206285 9:14693021-14693043 GTGCCTCCCCGCCCCAGGCCTGG - Intronic
1051876911 9:21802884-21802906 GTCCCTTGCCGCCGCGGGGAGGG + Intronic
1051876912 9:21802886-21802908 GTCCCTCCCCGCGGCGGCAAGGG - Intronic
1053381237 9:37651006-37651028 GACCGTGCCCGCCGCTGGGCGGG + Intronic
1060732665 9:126048220-126048242 CTCCCTCCCTGCCGAGGGGACGG + Intergenic
1060770292 9:126327151-126327173 GCCTGTCCCCGCCGCGGGCCGGG - Intronic
1061221324 9:129253808-129253830 GTCTCTCCCAGCCCCTGGGCTGG + Intergenic
1061365785 9:130172093-130172115 GGCCCTCCCCGCCGCGGCGGGGG + Intergenic
1061712745 9:132499034-132499056 GTCCCTGCCGGCGGCGGGGAAGG - Intronic
1062044693 9:134419601-134419623 GTTTCTCCCCAGCGCGGGGCAGG + Intronic
1062232128 9:135487536-135487558 GTCCCTCTCCGCTCCCGGGCTGG - Exonic
1062479743 9:136745770-136745792 GTCCCTGCCCGCAGGGGGCCTGG + Intronic
1203470433 Un_GL000220v1:113471-113493 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1203478254 Un_GL000220v1:157443-157465 CCCGCGCCCCGCCGCGGGGCGGG - Intergenic
1190308687 X:49101586-49101608 GTCCCTGCCCCGCGCGCGGCAGG + Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic