ID: 930136608

View in Genome Browser
Species Human (GRCh38)
Location 2:47908364-47908386
Sequence GGGTTGTTATATGTGGTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930136594_930136608 20 Left 930136594 2:47908321-47908343 CCCAACTCTCCTTCTAATATATT No data
Right 930136608 2:47908364-47908386 GGGTTGTTATATGTGGTATAAGG No data
930136598_930136608 11 Left 930136598 2:47908330-47908352 CCTTCTAATATATTAATGGGAGG No data
Right 930136608 2:47908364-47908386 GGGTTGTTATATGTGGTATAAGG No data
930136595_930136608 19 Left 930136595 2:47908322-47908344 CCAACTCTCCTTCTAATATATTA No data
Right 930136608 2:47908364-47908386 GGGTTGTTATATGTGGTATAAGG No data
930136593_930136608 21 Left 930136593 2:47908320-47908342 CCCCAACTCTCCTTCTAATATAT No data
Right 930136608 2:47908364-47908386 GGGTTGTTATATGTGGTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930136608 Original CRISPR GGGTTGTTATATGTGGTATA AGG Intergenic
No off target data available for this crispr