ID: 930137390

View in Genome Browser
Species Human (GRCh38)
Location 2:47915979-47916001
Sequence GCTTACTAATAAAATGGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930137386_930137390 6 Left 930137386 2:47915950-47915972 CCCAAGCTTCACTTTAAGTTTGG No data
Right 930137390 2:47915979-47916001 GCTTACTAATAAAATGGTACTGG No data
930137382_930137390 23 Left 930137382 2:47915933-47915955 CCTCTACCCAGCCATGACCCAAG No data
Right 930137390 2:47915979-47916001 GCTTACTAATAAAATGGTACTGG No data
930137388_930137390 5 Left 930137388 2:47915951-47915973 CCAAGCTTCACTTTAAGTTTGGT No data
Right 930137390 2:47915979-47916001 GCTTACTAATAAAATGGTACTGG No data
930137383_930137390 17 Left 930137383 2:47915939-47915961 CCCAGCCATGACCCAAGCTTCAC No data
Right 930137390 2:47915979-47916001 GCTTACTAATAAAATGGTACTGG No data
930137384_930137390 16 Left 930137384 2:47915940-47915962 CCAGCCATGACCCAAGCTTCACT No data
Right 930137390 2:47915979-47916001 GCTTACTAATAAAATGGTACTGG No data
930137385_930137390 12 Left 930137385 2:47915944-47915966 CCATGACCCAAGCTTCACTTTAA No data
Right 930137390 2:47915979-47916001 GCTTACTAATAAAATGGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930137390 Original CRISPR GCTTACTAATAAAATGGTAC TGG Intergenic
No off target data available for this crispr