ID: 930146058

View in Genome Browser
Species Human (GRCh38)
Location 2:48005783-48005805
Sequence GATAACCTTCAGAGAATTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930146058_930146063 4 Left 930146058 2:48005783-48005805 CCTATAATTCTCTGAAGGTTATC No data
Right 930146063 2:48005810-48005832 TTTGGGTTCTTCAAATTTTGGGG No data
930146058_930146066 28 Left 930146058 2:48005783-48005805 CCTATAATTCTCTGAAGGTTATC No data
Right 930146066 2:48005834-48005856 ATTTTTTGGGTTATCAAATTTGG No data
930146058_930146067 29 Left 930146058 2:48005783-48005805 CCTATAATTCTCTGAAGGTTATC No data
Right 930146067 2:48005835-48005857 TTTTTTGGGTTATCAAATTTGGG No data
930146058_930146068 30 Left 930146058 2:48005783-48005805 CCTATAATTCTCTGAAGGTTATC No data
Right 930146068 2:48005836-48005858 TTTTTGGGTTATCAAATTTGGGG No data
930146058_930146061 2 Left 930146058 2:48005783-48005805 CCTATAATTCTCTGAAGGTTATC No data
Right 930146061 2:48005808-48005830 TTTTTGGGTTCTTCAAATTTTGG No data
930146058_930146062 3 Left 930146058 2:48005783-48005805 CCTATAATTCTCTGAAGGTTATC No data
Right 930146062 2:48005809-48005831 TTTTGGGTTCTTCAAATTTTGGG No data
930146058_930146065 15 Left 930146058 2:48005783-48005805 CCTATAATTCTCTGAAGGTTATC No data
Right 930146065 2:48005821-48005843 CAAATTTTGGGGAATTTTTTGGG No data
930146058_930146064 14 Left 930146058 2:48005783-48005805 CCTATAATTCTCTGAAGGTTATC No data
Right 930146064 2:48005820-48005842 TCAAATTTTGGGGAATTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930146058 Original CRISPR GATAACCTTCAGAGAATTAT AGG (reversed) Intergenic
No off target data available for this crispr