ID: 930146065

View in Genome Browser
Species Human (GRCh38)
Location 2:48005821-48005843
Sequence CAAATTTTGGGGAATTTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930146058_930146065 15 Left 930146058 2:48005783-48005805 CCTATAATTCTCTGAAGGTTATC No data
Right 930146065 2:48005821-48005843 CAAATTTTGGGGAATTTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930146065 Original CRISPR CAAATTTTGGGGAATTTTTT GGG Intergenic
No off target data available for this crispr