ID: 930146067

View in Genome Browser
Species Human (GRCh38)
Location 2:48005835-48005857
Sequence TTTTTTGGGTTATCAAATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930146058_930146067 29 Left 930146058 2:48005783-48005805 CCTATAATTCTCTGAAGGTTATC No data
Right 930146067 2:48005835-48005857 TTTTTTGGGTTATCAAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930146067 Original CRISPR TTTTTTGGGTTATCAAATTT GGG Intergenic
No off target data available for this crispr