ID: 930146068

View in Genome Browser
Species Human (GRCh38)
Location 2:48005836-48005858
Sequence TTTTTGGGTTATCAAATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930146058_930146068 30 Left 930146058 2:48005783-48005805 CCTATAATTCTCTGAAGGTTATC No data
Right 930146068 2:48005836-48005858 TTTTTGGGTTATCAAATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930146068 Original CRISPR TTTTTGGGTTATCAAATTTG GGG Intergenic
No off target data available for this crispr