ID: 930147174

View in Genome Browser
Species Human (GRCh38)
Location 2:48019159-48019181
Sequence TCCAGGGATTTATCCACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930147174_930147177 3 Left 930147174 2:48019159-48019181 CCAAGTGTGGATAAATCCCTGGA No data
Right 930147177 2:48019185-48019207 AAGATGCATTTCTCCTTTCCTGG No data
930147174_930147182 20 Left 930147174 2:48019159-48019181 CCAAGTGTGGATAAATCCCTGGA No data
Right 930147182 2:48019202-48019224 TCCTGGGTTGTAACCTACTGGGG No data
930147174_930147178 4 Left 930147174 2:48019159-48019181 CCAAGTGTGGATAAATCCCTGGA No data
Right 930147178 2:48019186-48019208 AGATGCATTTCTCCTTTCCTGGG No data
930147174_930147180 18 Left 930147174 2:48019159-48019181 CCAAGTGTGGATAAATCCCTGGA No data
Right 930147180 2:48019200-48019222 TTTCCTGGGTTGTAACCTACTGG No data
930147174_930147181 19 Left 930147174 2:48019159-48019181 CCAAGTGTGGATAAATCCCTGGA No data
Right 930147181 2:48019201-48019223 TTCCTGGGTTGTAACCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930147174 Original CRISPR TCCAGGGATTTATCCACACT TGG (reversed) Intergenic
No off target data available for this crispr