ID: 930151634

View in Genome Browser
Species Human (GRCh38)
Location 2:48066154-48066176
Sequence TCTGCTGTGGAGGAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930151622_930151634 6 Left 930151622 2:48066125-48066147 CCCCTCTGCCAGTTAGTCATTGA No data
Right 930151634 2:48066154-48066176 TCTGCTGTGGAGGAGGTGGGTGG No data
930151624_930151634 4 Left 930151624 2:48066127-48066149 CCTCTGCCAGTTAGTCATTGACC No data
Right 930151634 2:48066154-48066176 TCTGCTGTGGAGGAGGTGGGTGG No data
930151623_930151634 5 Left 930151623 2:48066126-48066148 CCCTCTGCCAGTTAGTCATTGAC No data
Right 930151634 2:48066154-48066176 TCTGCTGTGGAGGAGGTGGGTGG No data
930151621_930151634 19 Left 930151621 2:48066112-48066134 CCAGCTCTTCATACCCCTCTGCC No data
Right 930151634 2:48066154-48066176 TCTGCTGTGGAGGAGGTGGGTGG No data
930151626_930151634 -2 Left 930151626 2:48066133-48066155 CCAGTTAGTCATTGACCCAGGTC No data
Right 930151634 2:48066154-48066176 TCTGCTGTGGAGGAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930151634 Original CRISPR TCTGCTGTGGAGGAGGTGGG TGG Intergenic
No off target data available for this crispr