ID: 930154644

View in Genome Browser
Species Human (GRCh38)
Location 2:48093566-48093588
Sequence TGGAGTAAATACAGCTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930154644_930154647 12 Left 930154644 2:48093566-48093588 CCAGCAAAGCTGTATTTACTCCA No data
Right 930154647 2:48093601-48093623 TTAGCAACCAGCATAGCCAACGG No data
930154644_930154649 21 Left 930154644 2:48093566-48093588 CCAGCAAAGCTGTATTTACTCCA No data
Right 930154649 2:48093610-48093632 AGCATAGCCAACGGAATCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930154644 Original CRISPR TGGAGTAAATACAGCTTTGC TGG (reversed) Intergenic
No off target data available for this crispr