ID: 930154649

View in Genome Browser
Species Human (GRCh38)
Location 2:48093610-48093632
Sequence AGCATAGCCAACGGAATCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930154645_930154649 1 Left 930154645 2:48093586-48093608 CCAGCAAGAATCACCTTAGCAAC No data
Right 930154649 2:48093610-48093632 AGCATAGCCAACGGAATCTATGG No data
930154644_930154649 21 Left 930154644 2:48093566-48093588 CCAGCAAAGCTGTATTTACTCCA No data
Right 930154649 2:48093610-48093632 AGCATAGCCAACGGAATCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930154649 Original CRISPR AGCATAGCCAACGGAATCTA TGG Intergenic
No off target data available for this crispr