ID: 930155847

View in Genome Browser
Species Human (GRCh38)
Location 2:48106951-48106973
Sequence TAGCCCTAGCCTCATATCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930155847_930155848 26 Left 930155847 2:48106951-48106973 CCAAGGATATGAGGCTAGGGCTA No data
Right 930155848 2:48107000-48107022 TGACCTACTTGTTTTTCAGATGG No data
930155847_930155849 27 Left 930155847 2:48106951-48106973 CCAAGGATATGAGGCTAGGGCTA No data
Right 930155849 2:48107001-48107023 GACCTACTTGTTTTTCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930155847 Original CRISPR TAGCCCTAGCCTCATATCCT TGG (reversed) Intergenic
No off target data available for this crispr