ID: 930155849

View in Genome Browser
Species Human (GRCh38)
Location 2:48107001-48107023
Sequence GACCTACTTGTTTTTCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930155847_930155849 27 Left 930155847 2:48106951-48106973 CCAAGGATATGAGGCTAGGGCTA No data
Right 930155849 2:48107001-48107023 GACCTACTTGTTTTTCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930155849 Original CRISPR GACCTACTTGTTTTTCAGAT GGG Intergenic
No off target data available for this crispr