ID: 930156451

View in Genome Browser
Species Human (GRCh38)
Location 2:48111826-48111848
Sequence CGCTGCGGTCTCGGGTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930156451_930156460 13 Left 930156451 2:48111826-48111848 CCTGAACACCCGAGACCGCAGCG No data
Right 930156460 2:48111862-48111884 AGTCCCAGTGGCAACTACAAAGG No data
930156451_930156456 1 Left 930156451 2:48111826-48111848 CCTGAACACCCGAGACCGCAGCG No data
Right 930156456 2:48111850-48111872 TCCGAGGCCCTGAGTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930156451 Original CRISPR CGCTGCGGTCTCGGGTGTTC AGG (reversed) Intergenic
No off target data available for this crispr