ID: 930156792

View in Genome Browser
Species Human (GRCh38)
Location 2:48114123-48114145
Sequence CTGAAAACAGAAATGAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930156792_930156800 27 Left 930156792 2:48114123-48114145 CCTAGTTTCATTTCTGTTTTCAG No data
Right 930156800 2:48114173-48114195 GCTTCTGAGCATCTATTTTTGGG No data
930156792_930156799 26 Left 930156792 2:48114123-48114145 CCTAGTTTCATTTCTGTTTTCAG No data
Right 930156799 2:48114172-48114194 AGCTTCTGAGCATCTATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930156792 Original CRISPR CTGAAAACAGAAATGAAACT AGG (reversed) Intergenic
No off target data available for this crispr