ID: 930159704

View in Genome Browser
Species Human (GRCh38)
Location 2:48142298-48142320
Sequence GAGATATGTCCCTTCTATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930159704 Original CRISPR GAGATATGTCCCTTCTATGC TGG Intergenic