ID: 930162400

View in Genome Browser
Species Human (GRCh38)
Location 2:48171554-48171576
Sequence CATGGAGCCTTGTCATCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930162392_930162400 20 Left 930162392 2:48171511-48171533 CCATGTCATTAGGCATTTCTCTC No data
Right 930162400 2:48171554-48171576 CATGGAGCCTTGTCATCCTGGGG No data
930162394_930162400 -7 Left 930162394 2:48171538-48171560 CCCTCTCCAGCAGCCACATGGAG No data
Right 930162400 2:48171554-48171576 CATGGAGCCTTGTCATCCTGGGG No data
930162395_930162400 -8 Left 930162395 2:48171539-48171561 CCTCTCCAGCAGCCACATGGAGC No data
Right 930162400 2:48171554-48171576 CATGGAGCCTTGTCATCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930162400 Original CRISPR CATGGAGCCTTGTCATCCTG GGG Intergenic
No off target data available for this crispr