ID: 930173547

View in Genome Browser
Species Human (GRCh38)
Location 2:48276943-48276965
Sequence CTCAAAGAAAACGTGAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930173547_930173548 -9 Left 930173547 2:48276943-48276965 CCTTGGCTCACGTTTTCTTTGAG No data
Right 930173548 2:48276957-48276979 TTCTTTGAGTGTCTCAAATATGG No data
930173547_930173549 9 Left 930173547 2:48276943-48276965 CCTTGGCTCACGTTTTCTTTGAG No data
Right 930173549 2:48276975-48276997 TATGGTACTCCCTTTTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930173547 Original CRISPR CTCAAAGAAAACGTGAGCCA AGG (reversed) Intergenic
No off target data available for this crispr