ID: 930177391

View in Genome Browser
Species Human (GRCh38)
Location 2:48314799-48314821
Sequence GACTCACCGTCAGCTCGGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930177391_930177397 -10 Left 930177391 2:48314799-48314821 CCCGGCCGAGCTGACGGTGAGTC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 930177397 2:48314812-48314834 ACGGTGAGTCCCGGGCGGAGCGG 0: 1
1: 0
2: 2
3: 6
4: 152
930177391_930177407 28 Left 930177391 2:48314799-48314821 CCCGGCCGAGCTGACGGTGAGTC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 930177407 2:48314850-48314872 GCGCTCCCCGCCCCAGCCCGCGG 0: 1
1: 1
2: 6
3: 59
4: 421
930177391_930177401 2 Left 930177391 2:48314799-48314821 CCCGGCCGAGCTGACGGTGAGTC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 930177401 2:48314824-48314846 GGGCGGAGCGGTCCCCTCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 116
930177391_930177402 6 Left 930177391 2:48314799-48314821 CCCGGCCGAGCTGACGGTGAGTC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 930177402 2:48314828-48314850 GGAGCGGTCCCCTCCAGGGTCGG 0: 1
1: 0
2: 0
3: 9
4: 116
930177391_930177400 1 Left 930177391 2:48314799-48314821 CCCGGCCGAGCTGACGGTGAGTC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 930177400 2:48314823-48314845 CGGGCGGAGCGGTCCCCTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930177391 Original CRISPR GACTCACCGTCAGCTCGGCC GGG (reversed) Exonic