ID: 930177391

View in Genome Browser
Species Human (GRCh38)
Location 2:48314799-48314821
Sequence GACTCACCGTCAGCTCGGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930177391_930177407 28 Left 930177391 2:48314799-48314821 CCCGGCCGAGCTGACGGTGAGTC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 930177407 2:48314850-48314872 GCGCTCCCCGCCCCAGCCCGCGG 0: 1
1: 1
2: 6
3: 59
4: 421
930177391_930177400 1 Left 930177391 2:48314799-48314821 CCCGGCCGAGCTGACGGTGAGTC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 930177400 2:48314823-48314845 CGGGCGGAGCGGTCCCCTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 85
930177391_930177397 -10 Left 930177391 2:48314799-48314821 CCCGGCCGAGCTGACGGTGAGTC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 930177397 2:48314812-48314834 ACGGTGAGTCCCGGGCGGAGCGG 0: 1
1: 0
2: 2
3: 6
4: 152
930177391_930177401 2 Left 930177391 2:48314799-48314821 CCCGGCCGAGCTGACGGTGAGTC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 930177401 2:48314824-48314846 GGGCGGAGCGGTCCCCTCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 116
930177391_930177402 6 Left 930177391 2:48314799-48314821 CCCGGCCGAGCTGACGGTGAGTC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 930177402 2:48314828-48314850 GGAGCGGTCCCCTCCAGGGTCGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930177391 Original CRISPR GACTCACCGTCAGCTCGGCC GGG (reversed) Exonic
904419829 1:30384432-30384454 GACTCACAGGCAGCTCTGGCTGG + Intergenic
905792678 1:40798704-40798726 GACCCATCGTCAGCTGGGCAGGG + Intronic
906686768 1:47767949-47767971 GGCTCAGCTTCAGCTAGGCCAGG + Intronic
907268165 1:53275304-53275326 GACTCAGCCTCTGCTCAGCCTGG + Intronic
911618303 1:100038429-100038451 GAGGCACCGGCAGCTCGGACAGG - Intronic
912564127 1:110573011-110573033 GACTGACCGTGAGCCAGGCCAGG + Intergenic
914086813 1:144461374-144461396 GACTCACCGCCCGCCCGGCCTGG + Intronic
914192714 1:145425316-145425338 GACTCACCGCCCGCCCGGCCTGG + Intergenic
914361402 1:146938997-146939019 GACTCACCTGCCGCCCGGCCTGG - Intronic
914491206 1:148151713-148151735 GACTCACCTCCCGCCCGGCCTGG + Exonic
914590620 1:149103264-149103286 GACTCACCGCCCGCCCGGCCTGG + Intronic
914884679 1:151575136-151575158 GACTCACCGTGAGCTTGCTCAGG + Intronic
1064384646 10:14879171-14879193 GCCTCTCCGCCCGCTCGGCCCGG + Intronic
1076792716 10:132785609-132785631 GGCGCCCCGGCAGCTCGGCCAGG + Exonic
1077392728 11:2307476-2307498 GACTCACCGTCAGGTACTCCAGG + Intronic
1081712284 11:45225012-45225034 GACCCATCGGCAGCTCTGCCAGG + Exonic
1081967623 11:47179097-47179119 GGCTCCCACTCAGCTCGGCCAGG - Intronic
1083777715 11:64902374-64902396 GACTCTCCGAGAGCTGGGCCAGG + Exonic
1084334565 11:68449059-68449081 GACTCATCCTGACCTCGGCCGGG + Exonic
1088833021 11:113554284-113554306 CACTCACCGCCAGCTGGGCCTGG - Intergenic
1099408550 12:82294231-82294253 GACTGACGGTCAGCAAGGCCAGG + Intronic
1101389884 12:104290666-104290688 GTCTCACTGTCACCTAGGCCAGG - Intronic
1102302817 12:111783283-111783305 GACTCACCGCCAGGTAGGTCCGG - Exonic
1104295360 12:127507023-127507045 GAGTCACCGTCACCGTGGCCTGG + Intergenic
1107406111 13:40115333-40115355 GACCCAGCCTAAGCTCGGCCTGG + Intergenic
1113705134 13:112425416-112425438 GGCTTCCCCTCAGCTCGGCCCGG + Intronic
1114528936 14:23383218-23383240 AACTCACCGCCTCCTCGGCCTGG + Exonic
1114534457 14:23414000-23414022 CACTCACCGCCTCCTCGGCCTGG + Exonic
1116899788 14:50350624-50350646 GACTCCCAGCCAGCTGGGCCTGG + Intronic
1119623774 14:76152558-76152580 GACTCAGCCTCATCTCTGCCCGG + Intronic
1119743048 14:77026712-77026734 GGCTCTCGCTCAGCTCGGCCAGG + Exonic
1122125493 14:99576429-99576451 GCCCCACCCTCAGCTCTGCCTGG + Intronic
1126049661 15:44674374-44674396 GATTCAAAGTCAGCTGGGCCAGG + Intronic
1128153525 15:65377791-65377813 GGCTCTCGGTCAGCTCGGCTCGG + Exonic
1129231136 15:74197745-74197767 GACTCACTGACAGCGAGGCCAGG + Exonic
1130448904 15:84031018-84031040 GACTCACAGTCAGCATGGCTGGG - Intronic
1133042497 16:3067995-3068017 GGCTCACCTCCAGCTCTGCCAGG - Exonic
1140033906 16:71358828-71358850 GGGACGCCGTCAGCTCGGCCAGG - Exonic
1142627975 17:1204057-1204079 GCCTCTCCCTCATCTCGGCCTGG + Intronic
1143651920 17:8268700-8268722 GACTCCCAGCCAGCCCGGCCAGG + Exonic
1152264004 17:79282872-79282894 GACTGACCCTCAGCTCTGCCTGG + Intronic
1153028667 18:693088-693110 GACTCACAGCCAGCTCTGCATGG + Intronic
1156350633 18:36298290-36298312 GCCGCGCCGTTAGCTCGGCCGGG + Intronic
1158326537 18:56319502-56319524 GACTCTCCGTCAGATCTTCCTGG + Intergenic
1166086831 19:40481764-40481786 GACTGACCATCAGCTGGGCATGG - Intronic
1166409734 19:42548508-42548530 GACTCACCTTCAGCATGGCTGGG - Intronic
1167313538 19:48751248-48751270 GAGCCATCGTCAGCTCTGCCTGG - Exonic
930177391 2:48314799-48314821 GACTCACCGTCAGCTCGGCCGGG - Exonic
931984520 2:67728699-67728721 GACTCACCGTTAGCACTGACAGG - Intergenic
934485153 2:94700364-94700386 GGCTCACTGTAAGCTCTGCCAGG - Intergenic
935127902 2:100240103-100240125 GACTCAGCCCCAGCTCAGCCTGG + Intergenic
938251968 2:129822387-129822409 GCCGCACCGTCAGCTCTTCCTGG + Intergenic
938928777 2:136067695-136067717 GACTCAGCGTAAGCCAGGCCGGG + Intergenic
1172671020 20:36634518-36634540 GTCTCAGCGACAGCTCGGCCGGG + Exonic
1173201965 20:40961004-40961026 GATTCACACTCAGCTCCGCCTGG - Intergenic
1174550675 20:51359290-51359312 GCCTCACCATCAGGTCAGCCAGG - Intergenic
1174915133 20:54645701-54645723 GACTCATGGTCAGCTCTCCCAGG + Intronic
1175483076 20:59325415-59325437 CACTCACAGTAAGCTCGGCTCGG - Exonic
1178314889 21:31559354-31559376 GAGGCTCCGTCAGCGCGGCCCGG + Intronic
1183317258 22:37143514-37143536 GACTCACCGTCTGTCCGGCCAGG + Exonic
1183613575 22:38927508-38927530 TCCTCTCCGACAGCTCGGCCAGG - Intergenic
952857596 3:37785063-37785085 GACTCACCGTCACCTCTTCTGGG - Exonic
954787013 3:53101255-53101277 GAGTCACCGTCAGCTGGGGTGGG - Intronic
956369978 3:68548873-68548895 TATTCACAGTCAGCTGGGCCTGG - Intergenic
956403742 3:68906732-68906754 AACTCACTGTCATCTGGGCCAGG + Intronic
961325561 3:126107302-126107324 GCCTCTCCGTCAGCAGGGCCTGG + Intronic
965608808 3:170523664-170523686 GACTCACCCTCAGGTGAGCCAGG + Intronic
970195538 4:13547427-13547449 GCCTCACCGGCCGCCCGGCCGGG - Intergenic
972356921 4:38288131-38288153 CACTCACCTTCAACTGGGCCTGG - Intergenic
990654194 5:57936183-57936205 CACTCACAGTCATCTCGCCCTGG + Intergenic
997791527 5:136766623-136766645 GACTCACCGTCAGCCAGGCTGGG - Intergenic
1000051863 5:157570186-157570208 GGCTCACTGTGAGCTCCGCCTGG - Intronic
1001527833 5:172441345-172441367 GACACACTGACTGCTCGGCCTGG + Intronic
1005174304 6:23026696-23026718 GACTCACCGCAACCTCCGCCTGG + Intergenic
1018085172 6:160295055-160295077 GGCTCACCGCAAGCTCCGCCGGG - Intergenic
1021058185 7:16076905-16076927 GACTCACAGTCAGCATGGCTGGG + Intergenic
1022485942 7:30777695-30777717 GCCTCACCAACAGCTCAGCCTGG - Intronic
1025079714 7:55970879-55970901 AACCCACCATCAGCTTGGCCTGG - Intronic
1027200314 7:76060075-76060097 GGATCACCTTCTGCTCGGCCGGG - Intronic
1029543050 7:101195940-101195962 GCCTCACCTTCATCTAGGCCTGG - Exonic
1029803178 7:102971520-102971542 GGCTCACCGCCACCTCCGCCCGG - Intronic
1034927436 7:155133499-155133521 AGCTGACCGTCAGCTCTGCCAGG + Intergenic
1035744777 8:1953922-1953944 AAGCCACCGTCAGGTCGGCCTGG - Intronic
1035790428 8:2298874-2298896 GCCTCACCGTCAGGCCTGCCAGG - Intergenic
1035802377 8:2422831-2422853 GCCTCACCGTCAGGCCTGCCAGG + Intergenic
1036595425 8:10207461-10207483 GACTCACCCCCAGTTCAGCCTGG + Intronic
1042149565 8:65767552-65767574 GACTCACAGTCAGAAAGGCCAGG - Intronic
1042156280 8:65847569-65847591 ACCTCACCCTCAGCTCTGCCTGG - Intergenic
1047339867 8:123970689-123970711 GACTCTTCCTCAGCTCTGCCAGG + Intronic
1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG + Intronic
1049853446 8:144846986-144847008 GACTCCTCCTCAGCTCGGCATGG - Intronic
1059459935 9:114423314-114423336 CCACCACCGTCAGCTCGGCCAGG - Exonic
1060797346 9:126521859-126521881 GCCTCTCCGTCAGCTTGCCCTGG + Intergenic
1062218521 9:135402191-135402213 GCCTCACCCCCAGCTCTGCCTGG + Intergenic