ID: 930178413

View in Genome Browser
Species Human (GRCh38)
Location 2:48324833-48324855
Sequence ATGTAAATGCAGTTGGAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930178413 Original CRISPR ATGTAAATGCAGTTGGAACA CGG Intronic
902666224 1:17940674-17940696 ATGTAAATGGTCTTGGAACAGGG - Intergenic
905024760 1:34842274-34842296 ACATCAATGCAGTTGTAACAGGG - Intronic
905187271 1:36205464-36205486 ATGTCAGTGCAGGTGGAGCAGGG + Intergenic
906940561 1:50251785-50251807 CTGTAAATACAGTGGGAACCTGG + Intergenic
908152952 1:61323215-61323237 CTTTAAATGCATTTGTAACATGG - Intronic
908381593 1:63602065-63602087 ATGCTAATGGTGTTGGAACAGGG + Intronic
908685897 1:66719343-66719365 CTGTAAATGCTGCTGCAACAGGG - Exonic
909753095 1:79189291-79189313 CTGTGAATGCAGTTGGCATAAGG - Intergenic
912096902 1:106156694-106156716 ATGTCAATGTGGTTGGAGCAAGG - Intergenic
912098700 1:106179022-106179044 GTCTCAATGCAGTTGGAAAAGGG + Intergenic
914350633 1:146836774-146836796 CTGTAAATGACGTTTGAACAGGG + Intergenic
917512262 1:175678335-175678357 ATGTGAATTCAGTGGGTACAGGG - Intronic
918031107 1:180812583-180812605 AAGTAAATACATTTAGAACATGG - Intronic
918863868 1:189869110-189869132 TTGAAGATGTAGTTGGAACAAGG - Intergenic
919147510 1:193654746-193654768 AGTCAAGTGCAGTTGGAACAAGG + Intergenic
922185320 1:223269449-223269471 AAGTAGATGCAGTTGGAAGTGGG - Intronic
923209279 1:231788518-231788540 ATGTGACTGCAGTTGGAAATAGG - Intronic
924853264 1:247852203-247852225 ATGCAAATACAGTTGGATCTGGG + Intergenic
1063610667 10:7559208-7559230 ATGTAAATGGGGTAGCAACATGG - Intergenic
1064542601 10:16420273-16420295 ATGGAAATGCATTGGGAAAATGG + Intergenic
1066647383 10:37623638-37623660 TTGAAAATGCAATGGGAACAGGG - Intergenic
1068512316 10:57982333-57982355 ATTTAAATGGTGTTGCAACAGGG - Intergenic
1069322073 10:67184346-67184368 ATGTAAAAGGAGATGGAACATGG - Intronic
1072574313 10:96686358-96686380 GTGTAAATCCAGTAGGAGCAGGG - Intronic
1072720277 10:97776186-97776208 ACATAAATGTAGTTGGAAAAGGG - Intergenic
1074094413 10:110297247-110297269 ATATAAACTCAGTTGGGACAAGG + Intronic
1074168933 10:110913722-110913744 AAGTAAATGCAGTTGACATATGG + Intronic
1074477288 10:113784665-113784687 ATCTGACTGCAGGTGGAACAGGG + Intergenic
1074739591 10:116472664-116472686 ATTTACAGGCAGTTGGACCAAGG - Intronic
1075793606 10:125103428-125103450 TTGTAAATGGACTTGGACCAAGG - Intronic
1078443539 11:11387111-11387133 ATGTAAATGCAGTCTGAAAACGG + Intronic
1078906460 11:15692549-15692571 ATGGTAATGCACTTGCAACAGGG - Intergenic
1078967627 11:16364762-16364784 TTGTAAATCCAGTTAGAAAAGGG + Intronic
1079798349 11:24835998-24836020 ATGTAAATGCAGATGCCATATGG + Intronic
1080162599 11:29195649-29195671 ATGCAAATGTAGTAGGAAGAAGG - Intergenic
1080604012 11:33849093-33849115 ATGTAAGTGCTGTGGTAACAGGG + Intergenic
1080694516 11:34589996-34590018 ATGAATATTCAGTTGGACCAAGG + Intergenic
1081036785 11:38158125-38158147 ATGTAACTGTATTTGGAATAGGG + Intergenic
1082019011 11:47515499-47515521 ATCAAAATGCAGTTGGAAAGAGG - Intronic
1082225353 11:49699646-49699668 AAGTAAATGAAATTGAAACAGGG - Intergenic
1083786810 11:64954297-64954319 ATGAAAATGAAGTCGGAATAAGG + Intronic
1086623740 11:88920059-88920081 AAGTAAATGAAATTGAAACAGGG + Intronic
1086782994 11:90930556-90930578 ATCTAACTGCTGTTAGAACATGG - Intergenic
1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG + Intronic
1087758453 11:102079630-102079652 ATGTAAAAGTAATTGGAAGAGGG - Intronic
1088859612 11:113787412-113787434 ATGCAAATGCAGTTCTCACAGGG - Intergenic
1090126574 11:124092612-124092634 ATGTAAATGCACTTTTAACCGGG + Intergenic
1090715383 11:129425957-129425979 ATGTAAATGAATTAGAAACACGG - Intronic
1092855486 12:12669571-12669593 ATGTATATACAGTTGGCTCAGGG - Intronic
1093403394 12:18775883-18775905 ATGAAAATGCAATTGGAGCAAGG + Intergenic
1093504556 12:19850137-19850159 TTGTAAATGGATTTGGAGCAAGG + Intergenic
1093902964 12:24657335-24657357 AAATAAATGAAATTGGAACAAGG - Intergenic
1096269182 12:50150471-50150493 ATGCAAATACACTTGGAAAAGGG + Intronic
1096316647 12:50573371-50573393 ATGGCAAGGCAGGTGGAACAAGG - Intronic
1096669983 12:53192830-53192852 ATGCGAATGCAGTGGGGACATGG - Exonic
1098819703 12:75211428-75211450 ATGTAAATTCAGTAGGTAAAAGG + Intergenic
1099708287 12:86185694-86185716 ATGTAAATTAAGTTGGCATATGG - Intronic
1101165257 12:102023649-102023671 AGCTAAATGCAGTTGAAACTGGG + Intronic
1102663027 12:114546182-114546204 ATGTAAATGCATTTGGAGACAGG + Intergenic
1103426056 12:120835127-120835149 ATTAAAAGGAAGTTGGAACAGGG - Intronic
1104217996 12:126753468-126753490 GTGTAAAGGCAGTTGGATCCAGG - Intergenic
1104274451 12:127312207-127312229 ATGTGTATGTATTTGGAACAGGG - Intergenic
1104469817 12:129020535-129020557 ATGTGAATGCATTTGGAAATAGG - Intergenic
1105580002 13:21686709-21686731 ATTTATGTGCAGTTGGCACATGG + Intronic
1106935992 13:34720598-34720620 ATGTAACAGGAGATGGAACATGG - Intergenic
1108350860 13:49589653-49589675 AGCTAAATGCAGGTGGAACAAGG - Intergenic
1108863413 13:54891316-54891338 ATGTAAATACGTTTGGAAAAAGG - Intergenic
1111787581 13:92809574-92809596 ATGTGAATGTACGTGGAACATGG - Intronic
1112883926 13:104145329-104145351 AAGTAAATGAAATTGGAAGAAGG - Intergenic
1115667512 14:35569082-35569104 ATGGAATTGCAGGTGGATCATGG - Intronic
1116750326 14:48875078-48875100 ATGTGACTGCAGTGGGAAAAAGG - Intergenic
1116761639 14:49022334-49022356 ATGAAAATGCAGTTGGCTCCAGG + Intergenic
1117682455 14:58218674-58218696 ATGTAGATCCAGGTGGAAGAAGG + Intronic
1118346200 14:64942884-64942906 CTGTAAGTGCTGTTTGAACAAGG + Intronic
1120541049 14:85751378-85751400 ATGTAAATGTAGCTTCAACAAGG - Intergenic
1121247126 14:92469819-92469841 ATATAAATGGAATTGTAACATGG - Intronic
1126231456 15:46331244-46331266 ATAGAAATGCAGTTGGAAATTGG + Intergenic
1131539159 15:93261481-93261503 ATGTAAATGCAGTTTAGAGAAGG - Intergenic
1134279166 16:12802796-12802818 TTTTAAATGCAGTTCAAACAAGG + Intronic
1134429993 16:14194460-14194482 ATGTGACTGCATTTGGAAAAAGG - Intronic
1135984010 16:27170347-27170369 ATGAAACTGCAGCTTGAACAAGG - Intergenic
1138040715 16:53662352-53662374 ATGTAAATGCAGTTTGCATTTGG - Intronic
1139983403 16:70878765-70878787 CTGTAAATGACGTTTGAACAGGG - Intronic
1143533743 17:7523198-7523220 ATCTAACTGCTGTTAGAACAAGG + Intergenic
1144240870 17:13310226-13310248 ATGAATAGGCAGTTGGAACTGGG + Intergenic
1144377639 17:14661376-14661398 ATGTAGATGCTGCTGGAACATGG - Intergenic
1145029223 17:19491934-19491956 ATGTGACTGTATTTGGAACAAGG + Intergenic
1146107246 17:30051048-30051070 ATTTTTATGCAGTTGGAACGTGG - Intronic
1146239975 17:31211403-31211425 ATGTAAATTCTGTTCCAACATGG - Intronic
1147878492 17:43638672-43638694 ATGTAAATGCAGGTGAATGAAGG + Intergenic
1150634463 17:66903291-66903313 ATGGAGATGCAGTTGGAGCAGGG + Intergenic
1150937647 17:69654596-69654618 ATATTTATGCAGTTGAAACAAGG - Intergenic
1153051420 18:906018-906040 TTCAAAATGCAGTTGGAACACGG - Intronic
1157392946 18:47318050-47318072 ATGTAAAGACAGTTGTGACAAGG + Intergenic
1158143051 18:54277653-54277675 ATGTAAATGAAGTTATAACTAGG - Intronic
1158297827 18:56018568-56018590 ATGTAAAAGCATTTGGCACAGGG + Intergenic
1159022867 18:63157287-63157309 AGGTAACTTCACTTGGAACAAGG - Intronic
1163844167 19:19629014-19629036 ACGTAAAGGCAGTTGGAGCTGGG - Intergenic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1165236292 19:34424459-34424481 AAGTAAATATAGTTGGAAGAGGG + Intronic
1168573116 19:57487037-57487059 ATGGAAGAGCAGTGGGAACATGG + Intergenic
925252106 2:2448298-2448320 ATGTAAATGGAGCTGGAAATGGG + Intergenic
929080089 2:38113861-38113883 ATTTAAATACAATTGGAAGAGGG - Intergenic
929302001 2:40315474-40315496 ATACAAAAGCAGTTGTAACAGGG - Intronic
930178413 2:48324833-48324855 ATGTAAATGCAGTTGGAACACGG + Intronic
930834928 2:55783113-55783135 ATAGAAATGCTGATGGAACAAGG + Intergenic
930963496 2:57289907-57289929 ATGCAAATGCAGTTGATATAAGG + Intergenic
932700878 2:73990687-73990709 ATGTAAATCCAGTTGGCTGAGGG - Intronic
934096440 2:88610501-88610523 ATACAAATGTAGTTGGAAAAGGG - Intronic
936124232 2:109773016-109773038 ATGTAAATGCCCTTGGACCATGG + Intergenic
936220456 2:110598448-110598470 ATGTAAATGCCCTTGGACCATGG - Intergenic
939131245 2:138237980-138238002 AAGGAAATACAGTTGGAAGAAGG - Intergenic
939645185 2:144688893-144688915 ATGTAAATGCAGGTGGTGCCTGG + Intergenic
941344749 2:164353977-164353999 ATGTACATGCAGTTGGTTAAGGG + Intergenic
942920034 2:181362030-181362052 AAGTCAGTGCAGTTGGAGCATGG - Intergenic
943631192 2:190254179-190254201 ATGTAACTGCATTTGGAAGCAGG + Intronic
943804467 2:192105771-192105793 AAGAAAATGCAGTTGGATTAAGG - Intronic
945854591 2:215053606-215053628 ATGTTAATGTAGCAGGAACATGG - Intronic
946668444 2:222075953-222075975 ATTTAAATACAGTTGGAAAAGGG - Intergenic
948165614 2:235859569-235859591 ATGGAAATACAGTTAGAAAAGGG - Intronic
1169955312 20:11096427-11096449 ATGTGAAAGCAGCTGGCACATGG + Intergenic
1170010835 20:11721896-11721918 AAGCAAAAGCAGATGGAACAAGG + Intergenic
1173881660 20:46418223-46418245 ATCTGAACACAGTTGGAACACGG - Intronic
1174146013 20:48453173-48453195 ATGTCCTTGCAGTTGGAACCTGG - Intergenic
1174499236 20:50972123-50972145 ATGTAAATCCAGTTGGAACAGGG + Intergenic
1174703077 20:52628891-52628913 TTGTAAATGGAGCTGGAATATGG + Intergenic
1179109760 21:38436380-38436402 ATCAAAATGCAGTTGGCACTTGG + Intronic
1179401535 21:41088982-41089004 TTGTAAATGTAGTTTGATCAAGG - Intergenic
1181099585 22:20530534-20530556 ATGGGAAAGCAGTTGGACCAGGG + Intronic
1182961527 22:34479936-34479958 ATTTCTATGCATTTGGAACATGG - Intergenic
952446139 3:33382877-33382899 ATGTAGATGCAGATGGAATTGGG - Intronic
954044028 3:47914074-47914096 ATGTAGATGCTGTTGGGCCATGG + Intronic
955390147 3:58516499-58516521 ATGTAAAAGCTTTTGGCACAGGG + Intronic
956319233 3:67977469-67977491 ATGTAACTGAAGTTGGTATAAGG + Intergenic
959192681 3:103135154-103135176 ATGTGAATACATTGGGAACAAGG + Intergenic
961462144 3:127057559-127057581 TTGAAAATTCAGTTGGAAGAGGG - Intergenic
962773478 3:138635749-138635771 ATGTCATTGCTGTTGGTACAGGG - Intergenic
963202190 3:142597030-142597052 TTGAAAATGCAGCTGAAACACGG - Intronic
963562130 3:146878798-146878820 TTGTAAATGCAATGAGAACATGG + Intergenic
964962633 3:162446857-162446879 ATGTAAGTTCAGTTAGACCACGG - Intergenic
965239015 3:166169814-166169836 ATGTAAATTTAGTTGGAAACAGG - Intergenic
966044782 3:175534624-175534646 ATATAAATGCAAGTGGAAGAGGG - Intronic
968551818 4:1227631-1227653 ATGCACATGCAGTTAGCACACGG - Intronic
970954051 4:21789963-21789985 ATGTATATGAAGATGGAAAATGG - Intronic
971253625 4:24993886-24993908 ACGTAAATGCAGATGGAAATGGG + Intergenic
971436695 4:26633606-26633628 TTGTAAATGCAGTTGGATTTAGG - Intronic
974134899 4:57803309-57803331 ATATAAATGAAGTTGGAAATTGG + Intergenic
974924754 4:68283293-68283315 ATGTAACTGCATTTGAAATAAGG + Intergenic
976391070 4:84504139-84504161 ATGTAATTGCAGTTGCACAAAGG - Intergenic
976482757 4:85563734-85563756 ATCTAGATGGAGTTGGAAAATGG + Intronic
977712603 4:100144932-100144954 ATGTAAAGGCAATTATAACAAGG + Intergenic
978180497 4:105789442-105789464 ATGTAAATGGACTTGGAAGTGGG - Intronic
980766028 4:137305470-137305492 AAGTAAATGCTGTTGAAACCAGG - Intergenic
982502452 4:156173741-156173763 ATGAACATGCTGTTGGAAAATGG - Intergenic
982866767 4:160523125-160523147 AAGTAAATGGAGTTGAAATATGG - Intergenic
982889505 4:160829944-160829966 AAATAATTGCAGTTAGAACATGG + Intergenic
983117290 4:163834052-163834074 AAACAAATGCAGTTGCAACATGG + Intronic
983562919 4:169118954-169118976 ATTTAAATGAATTTGGAATATGG - Intronic
984013508 4:174400214-174400236 ATGTCAATGCAACTGGAAGATGG + Intergenic
984604404 4:181767997-181768019 ATGTAAATGCAGAAGGCAAATGG + Intergenic
984995958 4:185430112-185430134 ATGTAAATGCTGTTTGCATAGGG - Intronic
988080715 5:26411095-26411117 TTGTTAAAGCAGTTGGAAGAGGG + Intergenic
989452473 5:41603140-41603162 ATGAAAATCAAGTTGCAACATGG + Intergenic
992659885 5:78948569-78948591 ATTTATATGCAGTAAGAACATGG + Intronic
993518504 5:88867819-88867841 ATGTCGATGCAGATGGAAAAAGG + Intronic
994337248 5:98581873-98581895 ATGTAGAAGCTGTTGGATCAGGG - Intergenic
994784808 5:104144187-104144209 ATGTAAATGTAGTTTTAAAAGGG - Intergenic
995213441 5:109567716-109567738 ATGTAAATAAGGTTGGAAGAAGG + Intergenic
996362197 5:122662086-122662108 TTGTAACAGCAGATGGAACATGG + Intergenic
996500209 5:124208196-124208218 ATGTGACTGCATTTGGAAAAAGG + Intergenic
997906877 5:137826091-137826113 ATGTAACTCCAGTTGGAGAAGGG - Intergenic
999481260 5:151950150-151950172 TTGTAAGTGCCATTGGAACAAGG + Intergenic
1000859145 5:166435372-166435394 TTGTAAATGAATTTGTAACATGG + Intergenic
1000972876 5:167734145-167734167 ATGAAAATGCAGATGGAGCAAGG + Intronic
1001976536 5:176004565-176004587 ATGTAACCGGAGATGGAACATGG - Intronic
1003737816 6:8897480-8897502 ATGTATATGCAGTTGGATGATGG + Intergenic
1003803685 6:9701286-9701308 ATGTTAATGCTGTTGGTCCAGGG + Intronic
1004748317 6:18535318-18535340 AGATAAAAGCAGTTGGAACATGG - Intergenic
1004786947 6:18978746-18978768 ATGTAAATGCAGGTGGTCCGAGG - Intergenic
1007690809 6:43699941-43699963 ATGTAAATGTTAGTGGAACATGG - Intergenic
1008326502 6:50188082-50188104 ATGTAAATGCACTTCCAAAATGG - Intergenic
1008430270 6:51408477-51408499 ATTTAAGTGCAGTTTTAACAAGG - Intergenic
1009274942 6:61663519-61663541 ATATATATGCAGCTGGGACATGG + Intergenic
1009626054 6:66139858-66139880 ATCTAACTGCAGTTAGAATATGG + Intergenic
1012314700 6:97771767-97771789 ATGAAAATGTTGTTGAAACATGG + Intergenic
1013115290 6:107098948-107098970 AACTAAATGCTCTTGGAACATGG - Intronic
1014294234 6:119598939-119598961 ATGTAAATGCATTTGGAGATAGG + Intergenic
1014832016 6:126113925-126113947 ATGTCAATGCTGTTGGTCCATGG + Intergenic
1015561965 6:134525606-134525628 GTGAAAATGCAGTTGTTACAGGG + Intergenic
1015911967 6:138178061-138178083 ATTTAAATGCATTTGGAGCAAGG + Intronic
1017519888 6:155192805-155192827 AGGTACATGTAGTTGGAAAAGGG + Intronic
1017651318 6:156585629-156585651 AGGTAAATTCAATTGGATCATGG + Intergenic
1018188201 6:161286356-161286378 AGTTAAATGCAGCTGGAAGAGGG - Intergenic
1019367619 7:643204-643226 ATGCCAATGCAGTTTGAAGATGG - Intronic
1020563492 7:9766276-9766298 ACGTAAATGCAGTAAGAAAAGGG - Intergenic
1021237070 7:18155308-18155330 ATGTAGAGGCATTTGGAATATGG + Intronic
1026962601 7:74418064-74418086 GTGTAAATTCAGAAGGAACATGG + Intergenic
1027558675 7:79698748-79698770 AAGTAAAAGCAGTTAGAATATGG + Intergenic
1028775038 7:94666262-94666284 ATGGAAATGGAGTTTGAAGACGG - Exonic
1030657929 7:112188704-112188726 ATGTAAATTCTGTTACAACAAGG - Intronic
1033870584 7:145750011-145750033 ATGTAACTGCTGTTAGAATATGG + Intergenic
1036180291 8:6578773-6578795 ATGTAAAGGCAGGTGGCACCTGG + Intronic
1039703190 8:39981781-39981803 ATGAAAATGGAGATGGAAGAGGG + Intronic
1039786802 8:40841308-40841330 ATGTAAATGCATCTGGGACCAGG + Intronic
1040677272 8:49765685-49765707 CTGCCAATGCAGTTAGAACAAGG + Intergenic
1040706408 8:50133819-50133841 ATGTAAACTCATTTGGAAAAGGG - Intronic
1042400719 8:68343123-68343145 ATCTAAATGCAATTAGAAAATGG + Intronic
1045002732 8:97892567-97892589 ATGGATATGTAGTTGGAAAAGGG + Intronic
1045660533 8:104432928-104432950 ATGTAACTGTATTTGGAAAAAGG + Intronic
1045731433 8:105246432-105246454 ATCTAAAGGCAATGGGAACATGG + Intronic
1045923236 8:107557206-107557228 AAGTAAATGGAGTTGGTAAAAGG - Intergenic
1046523055 8:115350117-115350139 ATGTAAATGAAGTGGGAAGTAGG - Intergenic
1046914879 8:119669343-119669365 ATGTGAATGCACCTGAAACATGG - Intronic
1048099163 8:131329046-131329068 CAGATAATGCAGTTGGAACAAGG - Intergenic
1048715344 8:137262654-137262676 ATCTGAAAGCAGTTGGAAAATGG + Intergenic
1050334019 9:4573600-4573622 ATATATATGCACTAGGAACACGG + Intronic
1050748446 9:8906309-8906331 TTGTAAAAGAATTTGGAACAAGG - Intronic
1055181649 9:73395222-73395244 ATGAAAATGCATTTGAAGCAAGG - Intergenic
1056991712 9:91419318-91419340 ATGTAAATGCGATTGCAGCATGG - Intronic
1057665568 9:97042387-97042409 ATGTAAATGCAGAAGAAATATGG + Intergenic
1060085163 9:120692656-120692678 AGGTACATGAAGGTGGAACAGGG - Intronic
1061476425 9:130870281-130870303 ATGTACATGCAAAAGGAACATGG - Intronic
1062090991 9:134678797-134678819 AGCTAAATGCCGTTGGAACTGGG + Intronic
1186201993 X:7164294-7164316 ATGTAATTGCAAGTGGAAAAGGG + Intergenic
1187559185 X:20384554-20384576 ATATAAATCCAGCTGTAACATGG - Intergenic
1188975729 X:36673028-36673050 AGGTTAATACACTTGGAACAAGG - Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1193330409 X:80229916-80229938 ATGTAACTGCCGTTAGAACAGGG - Intergenic
1193699906 X:84747825-84747847 ATCTAACTGCAGTTAGAATAAGG - Intergenic
1195048014 X:101071907-101071929 ATGTAAAAGCATTGGGAATATGG + Intergenic
1195404710 X:104500162-104500184 AGGTAAATGCAGTTTGCAGATGG + Intergenic
1197903561 X:131399183-131399205 ATGTAAATGCTGAAGGAAAAGGG + Intronic
1198941531 X:141962618-141962640 ATGCAAAAGCAATTGGATCAGGG + Intergenic
1201693371 Y:16794449-16794471 ATGTAGAATCAGTGGGAACATGG - Intergenic