ID: 930178549

View in Genome Browser
Species Human (GRCh38)
Location 2:48326382-48326404
Sequence GGTTAAGGATTTTGACCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930178543_930178549 24 Left 930178543 2:48326335-48326357 CCTGAAAGGTTAGAGCATGGCTA 0: 1
1: 0
2: 0
3: 5
4: 102
Right 930178549 2:48326382-48326404 GGTTAAGGATTTTGACCTAAGGG 0: 1
1: 0
2: 1
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930178549 Original CRISPR GGTTAAGGATTTTGACCTAA GGG Intronic
902200386 1:14829049-14829071 GGTGAAGGATCATGAACTAATGG - Intronic
903094590 1:20958350-20958372 GGTTGAGGATTTTATCATAAAGG - Intronic
904405930 1:30287918-30287940 GGTGAAGGATTTGGAGCTGAGGG - Intergenic
904822004 1:33251585-33251607 GGTTTAGGATTTTATCTTAAGGG - Intergenic
909157539 1:72097570-72097592 GGTTAACGTTTTTGAACTTAAGG - Intronic
909168492 1:72260523-72260545 GGTTAAGCACTTTGTCCGAAAGG + Intronic
915049456 1:153052443-153052465 AATTAAGGATATTGACCTGATGG - Intergenic
916175701 1:162036551-162036573 CTTTAAGGATTTTGACCTTGGGG - Intergenic
916777728 1:167985579-167985601 AATTAAGGATTTTGACCATAAGG - Intronic
920124232 1:203680930-203680952 GGTTAAGGAGTTCTACTTAAGGG + Intronic
924042727 1:239999060-239999082 GGATAAGAATTTTGAATTAATGG + Intergenic
1066493178 10:35914715-35914737 AGTTAAGAGTTTTTACCTAATGG - Intergenic
1068679528 10:59804609-59804631 CATTCAGGATTTTGACCTCAAGG - Intronic
1069125032 10:64619480-64619502 GGTCAAGGATTTTGAAATAAGGG - Intergenic
1070515880 10:77205470-77205492 GGGTGAGGATTTTAACCCAAAGG + Intronic
1072749900 10:97970372-97970394 GGAGAAGGATTTTGAGCCAAGGG - Intronic
1072904965 10:99444722-99444744 AATCAAGGATTTTGCCCTAATGG + Intergenic
1074566356 10:114581843-114581865 GGAACAGGATTTTGGCCTAAGGG - Intronic
1079903756 11:26220773-26220795 GCTTAAGGCTTCTGGCCTAATGG + Intergenic
1080920617 11:36705590-36705612 TGTTAAGGATTTAGAGCAAAAGG + Intergenic
1081379552 11:42398076-42398098 ATTCAAGGATATTGACCTAAAGG - Intergenic
1082274126 11:50203006-50203028 GGTTAAGGACTTTGAGATGAGGG - Intergenic
1082725558 11:56731058-56731080 AATTTAGGATTTTGACCTGAGGG + Intergenic
1085499268 11:77004171-77004193 AGTTAAGGTTTGTTACCTAAAGG + Intronic
1092984937 12:13836344-13836366 GGTTAGGAATTCTGGCCTAAGGG + Intronic
1097713927 12:62945050-62945072 TGTTAAGGATTTTAACCAATTGG - Intergenic
1098671991 12:73242316-73242338 GGTTAAGGCCTTTAACTTAAAGG + Intergenic
1099405070 12:82249342-82249364 GGGTAATGATTTTAACATAAAGG + Intronic
1100110846 12:91240586-91240608 CGTTACGGATTTTCAACTAAGGG + Intergenic
1101623989 12:106420475-106420497 TTTTAAGGCTTTTCACCTAAGGG - Intronic
1101978959 12:109388754-109388776 GGTTCAGGATTTTGTGCTATTGG + Exonic
1103538939 12:121652793-121652815 GGTCTAGGATTTTGACCTGGAGG + Exonic
1106806621 13:33314446-33314468 GGATAAGGACTTTGGCATAAGGG + Intronic
1107567832 13:41624626-41624648 TGTTAAGGGTTTTAACATAAAGG - Intronic
1110462684 13:75763059-75763081 GGACAAGAATTTTGACCCAAAGG - Intronic
1111688653 13:91532897-91532919 AGTAAAAGATCTTGACCTAATGG + Intronic
1112939804 13:104847859-104847881 GGTTAAGCAGCTTGTCCTAAGGG - Intergenic
1117243261 14:53857090-53857112 GTTTAAGGATTTAGACTTTAAGG + Intergenic
1119294934 14:73525356-73525378 GGTTATTGATTCTGGCCTAATGG - Intronic
1122759166 14:104008470-104008492 AGTTAAGTTTTTTGACCAAATGG + Intronic
1125155144 15:36577551-36577573 GGTTAAGGATTTTTTTTTAAAGG - Intergenic
1125349976 15:38756225-38756247 GGTAAAAGAGTGTGACCTAATGG - Intergenic
1131815803 15:96219952-96219974 GGTTAAGGATGTTAAGATAAGGG + Intergenic
1136511864 16:30743060-30743082 TTTTTAGGATTTTGCCCTAATGG - Intronic
1138158902 16:54734926-54734948 GGTAAATGATTTTGAAATAAAGG - Intergenic
1139621539 16:68148626-68148648 GGTTCAGGAATTTGACGTACTGG + Intronic
1144521200 17:15953260-15953282 GGTTTTGGATTTTGTCCTGAAGG + Intronic
1146728347 17:35173720-35173742 AGTTAAGGATTTTGAGATGAGGG - Intronic
1151998408 17:77628214-77628236 GGTTAAGGATTGTGGCTCAAGGG + Intergenic
1152004114 17:77666903-77666925 GCTTAAGGTTTTTGCCTTAAAGG - Intergenic
1154138267 18:11800089-11800111 GTTGAAGGTTGTTGACCTAATGG - Intronic
1155364829 18:25039443-25039465 GATTAAGGATCTTGAGATAAGGG - Intergenic
1156067304 18:33159650-33159672 AATTAAGGATTTTGAAATAAGGG - Intronic
1161290926 19:3492876-3492898 GGCTTGGGATTTTGTCCTAAAGG + Intronic
1164323328 19:24170059-24170081 GGTTAAGGATTTTGATAAGAAGG + Intergenic
1167423228 19:49415779-49415801 GGTTAAGGACTATGTCATAAAGG + Intronic
926387942 2:12356266-12356288 AGTTAGGGATTTTGGCTTAAGGG + Intergenic
926517016 2:13859715-13859737 AGGTAAGGATTTTGACACAAAGG + Intergenic
927534083 2:23838476-23838498 GCTAAAGGATTTTGATCCAAGGG - Intronic
928424885 2:31169582-31169604 GGTTCAGGAACTTGACCCAATGG + Intergenic
930178549 2:48326382-48326404 GGTTAAGGATTTTGACCTAAGGG + Intronic
932527865 2:72491372-72491394 GGTTAATGATACTGACCTATAGG - Intronic
932860336 2:75284961-75284983 GTTTTAGAATTTTGAACTAATGG + Intergenic
933027884 2:77285050-77285072 GGTTCAGGATATTTAACTAAAGG + Intronic
935120768 2:100181688-100181710 GGCTCAGGATTTTGAACTACAGG + Intergenic
937722779 2:125122967-125122989 GGTTAAGGATTTTTGCATATAGG + Intergenic
939538333 2:143461322-143461344 GTTTAAGGATTTTAATGTAAAGG - Intronic
941376147 2:164733282-164733304 GGTTAAGAATATTAACATAATGG + Intronic
942829054 2:180217078-180217100 GTTGAAGGTTTTTAACCTAAAGG - Intergenic
946174530 2:217914266-217914288 GGTGAAGGGTTCTGACCTCAGGG - Intronic
947471183 2:230402797-230402819 GTATAAGGATTTTGGCCAAATGG + Exonic
948147740 2:235720723-235720745 GGGTCAGGATTATGACATAAAGG - Intronic
1175187396 20:57187942-57187964 GGTTCAGATTTTTAACCTAAAGG + Intronic
1175414828 20:58794418-58794440 GGGCAAGGACTTTGTCCTAAAGG - Intergenic
1178755118 21:35341752-35341774 AGTTAATGATTTTGACATGAGGG - Intronic
1178810408 21:35876569-35876591 TGTTAAGGATGTTGTCCTGAAGG + Intronic
1181895431 22:26103395-26103417 TTTTAAAGATTCTGACCTAAAGG - Intergenic
950875454 3:16267394-16267416 GGGTAAGAATTTTATCCTAAGGG - Intronic
951039103 3:17968496-17968518 GGAAAAGGATTTTGTCCCAATGG + Intronic
951152734 3:19311342-19311364 GGTTAAGTAATTTGCCCTAGTGG + Intronic
952336523 3:32407993-32408015 AGTTAAGGATCTTGAAATAAGGG + Intronic
952540582 3:34363452-34363474 GGTTAAGGATTTTGCAAAAAAGG - Intergenic
956114455 3:65904440-65904462 GGTTTTGGATTTTGTTCTAAGGG - Intronic
956555514 3:70518181-70518203 AGTTAAGCATTTTAACATAACGG + Intergenic
958598543 3:96262293-96262315 TTTTAAAGTTTTTGACCTAAAGG - Intergenic
959862169 3:111228956-111228978 TTTTAAGTATTTTGACCAAAAGG + Intronic
959979597 3:112500902-112500924 GGTTATGGCTTTTGACCTGTGGG - Intergenic
961167607 3:124774302-124774324 AGTTAAGGATTTTGAGATGAGGG + Intronic
965042139 3:163522391-163522413 GATTAAGTATTTTGATCTAAAGG - Intergenic
965043833 3:163549424-163549446 GGTTAAAGATTCTAACCTATGGG + Intergenic
967287516 3:187887881-187887903 GAACAAAGATTTTGACCTAAAGG + Intergenic
969577006 4:8042101-8042123 TGCTGAGGACTTTGACCTAAGGG + Intronic
975978843 4:80132044-80132066 AGTTAAGGATCTTGAGATAAGGG + Intergenic
976484828 4:85589742-85589764 ATTAAAGTATTTTGACCTAATGG - Intronic
976746472 4:88407984-88408006 AGGTAAGGATTTTGAGATAAGGG + Intronic
982444908 4:155479031-155479053 AGTAATGGATTTTGACCTTAAGG + Intergenic
986100540 5:4605917-4605939 GGTTCAGGATCTTTACCCAAAGG - Intergenic
988081886 5:26425747-26425769 GGTTAAGGATCTTGAGCTGGTGG - Intergenic
988690434 5:33566648-33566670 CAATAAGGATTTTGACCTATTGG - Intronic
991423110 5:66461709-66461731 GGTTAAAGATTTTGAAAAAAGGG + Intergenic
992985439 5:82224292-82224314 GGTTTAGGATTTTTACCTAGAGG + Intronic
994604422 5:101949143-101949165 CATTAAGGTTATTGACCTAAGGG + Intergenic
1001414577 5:171536058-171536080 GGTTAAGGATTGGCACATAATGG - Intergenic
1005013878 6:21359731-21359753 GGCTAAGGATTTGGGCCAAATGG + Intergenic
1006501059 6:34459072-34459094 GGTTAAGTACTTTGAACTAAAGG - Intergenic
1007695753 6:43733491-43733513 GGTTAAGGAACTTAACCTTAGGG - Intergenic
1009914151 6:69971956-69971978 GATTCAGGATTTTAACCTAATGG - Intronic
1012642605 6:101638584-101638606 GATTAAGAATTTTGAGCTAAAGG + Intronic
1014421302 6:121249268-121249290 TGTTAAGGGTTTTAATCTAAAGG - Intronic
1014607606 6:123496648-123496670 GGGGAAGGATTTTGAGTTAAAGG - Intronic
1014961711 6:127694900-127694922 GGTTAAATATTTTGAGCTATTGG - Intergenic
1017546583 6:155457876-155457898 GGTTAAGTATTTTGACAAACAGG + Intergenic
1019703155 7:2484090-2484112 GGATAAGGATTTTGACATATTGG + Intergenic
1020941399 7:14542954-14542976 AATTAAGGATTTTGAGATAAAGG + Intronic
1022598264 7:31733080-31733102 GGTTAAAGGTTTTCCCCTAAAGG + Intergenic
1024652415 7:51416389-51416411 GGCTAAGGATTTAGACATCAAGG + Intergenic
1025037593 7:55607038-55607060 GGCTAAGGATTTAGACATCAAGG + Intergenic
1025625653 7:63218939-63218961 GGTTAAGGACTTTGAGATGAGGG + Intergenic
1025656462 7:63524234-63524256 GGTTAAGGACTTTGAGATGAGGG - Intergenic
1026189571 7:68112548-68112570 GGTTAAGGACTTTGAGATGAGGG - Intergenic
1027871133 7:83709790-83709812 GGTTAAGTAGTTTTACCTGAGGG + Intergenic
1029526861 7:101100086-101100108 GGTCTGGAATTTTGACCTAAGGG + Intergenic
1029532967 7:101137621-101137643 GACTAGGGAGTTTGACCTAAAGG - Exonic
1030332424 7:108285271-108285293 GGTATAGTATTTTGCCCTAAAGG - Intronic
1030690303 7:112525817-112525839 GGTAAATAATTTTTACCTAAAGG + Intergenic
1031834511 7:126667025-126667047 AGTAAAGGATTTTGACCTAATGG + Intronic
1033101339 7:138475285-138475307 GGTTTGGGCTTTTGTCCTAATGG - Intronic
1038852559 8:31294306-31294328 GTTTAAGGATTTTGACATTTAGG + Intergenic
1039172876 8:34768440-34768462 GGTTAAGTGTTTTGACCTGCTGG - Intergenic
1039179908 8:34854841-34854863 GGTTCAGGATTTTGGCATGATGG + Intergenic
1040992193 8:53364411-53364433 GGTTAAGGAACTTGACCTTAGGG - Intergenic
1042268878 8:66936091-66936113 GTTAAAGGATTTGGACGTAAGGG - Intergenic
1043492792 8:80765694-80765716 GTTTAGGGATTTTGACCTTTTGG + Intronic
1043781263 8:84338885-84338907 GGTTACTGATTTTGACATATTGG - Intronic
1052278680 9:26707760-26707782 GGTTAAAAATTCTGATCTAAAGG - Intergenic
1054704850 9:68452115-68452137 GCTGTGGGATTTTGACCTAAAGG + Intronic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1056182328 9:84097489-84097511 GGCAAATGAATTTGACCTAAAGG + Intergenic
1057700679 9:97361262-97361284 GGTCAATGTTTTTGACCAAATGG - Intronic
1187677232 X:21728307-21728329 TTTTAAGGATTTTGACAAAAAGG - Intronic
1195990072 X:110673443-110673465 TCTTAAGTATCTTGACCTAAAGG + Intergenic
1196413948 X:115450744-115450766 GGTTAAAGATTTTGAGAAAAGGG + Intergenic
1199582588 X:149375314-149375336 GGTTAATGATTTTGTCCTACTGG + Intergenic