ID: 930180652

View in Genome Browser
Species Human (GRCh38)
Location 2:48352624-48352646
Sequence AAATTCAGTGTGTCCGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930180648_930180652 22 Left 930180648 2:48352579-48352601 CCCAGACGTAAATTTGCAACTAA 0: 1
1: 0
2: 0
3: 3
4: 91
Right 930180652 2:48352624-48352646 AAATTCAGTGTGTCCGAAATTGG 0: 1
1: 0
2: 2
3: 14
4: 183
930180649_930180652 21 Left 930180649 2:48352580-48352602 CCAGACGTAAATTTGCAACTAAT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 930180652 2:48352624-48352646 AAATTCAGTGTGTCCGAAATTGG 0: 1
1: 0
2: 2
3: 14
4: 183
930180647_930180652 29 Left 930180647 2:48352572-48352594 CCTAAAGCCCAGACGTAAATTTG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 930180652 2:48352624-48352646 AAATTCAGTGTGTCCGAAATTGG 0: 1
1: 0
2: 2
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930180652 Original CRISPR AAATTCAGTGTGTCCGAAAT TGG Intronic
902643359 1:17780772-17780794 AGCCTCAGTGTGTCCCAAATTGG - Intronic
904888911 1:33763373-33763395 CAATTCAGTAGGTCCAAAATGGG - Intronic
907889693 1:58624820-58624842 AATCCCAGTGTGTCCGGAATTGG - Intergenic
910236520 1:85042262-85042284 AGATTTAGTGTGTCAGACATGGG - Intronic
912166370 1:107046157-107046179 AGAGACAGTGTGTCCGGAATTGG - Intergenic
912312685 1:108639885-108639907 GAAATAAGTGTGTCCGGAATTGG + Intronic
912577145 1:110683319-110683341 AAGCTCAGTGTGTCTGAAGTGGG + Intergenic
912736121 1:112150852-112150874 AAAGCCAGTGTGGCAGAAATGGG + Intergenic
915865357 1:159493644-159493666 AAACCCAGTGTGTCCGGAATTGG + Intergenic
917025490 1:170637306-170637328 AAATTCAGTGTTTCACAATTTGG + Intergenic
917406502 1:174712626-174712648 AAAACCACTGTGTCCGGAATTGG - Intronic
918302350 1:183215951-183215973 AAATTCACTGGGGCCAAAATGGG - Intronic
918529032 1:185496927-185496949 ACTTTCAGTGTGTCAGACATTGG + Intergenic
919306088 1:195839801-195839823 AAATTAAGTGTTTCAGAAAAAGG - Intergenic
919830063 1:201534313-201534335 AAATTTACTGTGTCCTTAATTGG + Intergenic
920447832 1:206033213-206033235 AAATTCAGAGAGTACAAAATAGG - Intergenic
920878292 1:209857849-209857871 AAATCCAGTGTGTCCGGAATTGG + Intergenic
921785716 1:219227537-219227559 AAATTTAGTGTGTCCCATTTGGG + Intergenic
921997004 1:221431310-221431332 AAATCCAGTGTGTACAAATTGGG - Intergenic
923299328 1:232627103-232627125 AAATTCAGTGTGTCTTTAAAAGG + Intergenic
924132692 1:240928273-240928295 AAATCCAGTGTGTTGGAAAAGGG - Intronic
924632051 1:245750564-245750586 AAATGCTGTGTGTCAGGAATTGG - Intronic
1064197971 10:13260824-13260846 AATCCCAGTGTGTCCGGAATTGG - Intergenic
1071754490 10:88521455-88521477 CAATTCAGTCTGTCCCTAATGGG + Intronic
1073897265 10:108177160-108177182 AAATTCAGAGGCTCCCAAATGGG - Intergenic
1087376690 11:97351597-97351619 AAATTTAGTGTGTGTGACATGGG + Intergenic
1087430380 11:98046084-98046106 AATTTCAGAGTGTACCAAATGGG + Intergenic
1090434562 11:126676077-126676099 AAATTCAGTATGTCCCAAACTGG - Intronic
1094000349 12:25687766-25687788 AATCCCAGTGTGTCCGAAATTGG - Intergenic
1095193471 12:39285648-39285670 AAAGTGAATGTGTCAGAAATAGG + Intergenic
1095222927 12:39639569-39639591 AAATCCAGGGTGTCTGATATTGG - Intronic
1095848507 12:46774317-46774339 AAATTCAGTGTTTATGAAACAGG + Intronic
1095918563 12:47505761-47505783 AAATCCAGTTTGTCTGAATTGGG + Intergenic
1097731379 12:63132023-63132045 TGATTCAGTATGTCTGAAATAGG + Intergenic
1097920365 12:65066050-65066072 AATTTTAGTATGTCCTAAATTGG - Intronic
1099066591 12:77988188-77988210 AAATTCAGTAAGTCTGAGATGGG + Intronic
1103101954 12:118184668-118184690 AAATTGAGTAAGTCTGAAATGGG + Intronic
1103145954 12:118596209-118596231 AATCCCAGTGTGTCCGGAATTGG + Intergenic
1103783203 12:123413240-123413262 AATCCCAGTGTGTCCGGAATTGG + Exonic
1103853462 12:123948091-123948113 AAAGGAAGTGTGTCCGGAATTGG - Intronic
1106600366 13:31182181-31182203 AATCCCAGTGTGTCCGGAATTGG + Intergenic
1107259186 13:38471438-38471460 GTACTCAGTGTGTCCGGAATTGG + Intergenic
1108439933 13:50441185-50441207 TAATTCAGTTGGTCTGAAATGGG - Intronic
1109145561 13:58774413-58774435 TACCTCAGTGTGTCCGGAATTGG - Intergenic
1109416256 13:62045417-62045439 AATATGAGTGTGTCCGAAACTGG + Intergenic
1110999681 13:82164217-82164239 TATCTCAGTGTGTCCGGAATTGG + Intergenic
1112386328 13:98943331-98943353 ATATTGAGTGTGTCCCACATGGG - Intronic
1113005456 13:105696714-105696736 GAATTCAATGTGTTCAAAATTGG + Intergenic
1115171419 14:30512122-30512144 AGATTCAGTGTCTCTGAAATGGG + Intergenic
1119027956 14:71168677-71168699 AATCCCAGTGTGTCCGGAATTGG - Intergenic
1123797817 15:23791120-23791142 GAAGTCAGTGTGTCTGAAACTGG - Intergenic
1124114652 15:26830147-26830169 AGTTGCAGTGTGTCCGGAATTGG + Intronic
1128669813 15:69566615-69566637 AATCCCAGTGTGTCCGGAATTGG + Intergenic
1129605618 15:77023642-77023664 AAATTCAGCGTGTCCAAAACCGG - Intronic
1135693249 16:24562713-24562735 TGCTTCAGTGTGTCTGAAATGGG - Intronic
1138014111 16:53413571-53413593 AATCCCAGTGTGTCCGGAATTGG - Intergenic
1139141132 16:64264010-64264032 AATTTCAGTGTGTCTGGAGTTGG + Intergenic
1139184508 16:64789942-64789964 ATATTCAGTGGGTCTAAAATGGG - Intergenic
1143845603 17:9770972-9770994 AAATTCAGTGTCTCAGACACAGG + Intergenic
1146319023 17:31832018-31832040 AATCCCAGTGTGTCCAAAATTGG + Intergenic
1147676516 17:42210203-42210225 AGATTCAGTGACTCAGAAATTGG - Exonic
1148322804 17:46767749-46767771 AAATTCAGTGTGTGCACATTAGG - Intronic
1150835217 17:68557690-68557712 TAATTCTGGGTGTCAGAAATAGG - Intronic
1151036571 17:70807486-70807508 AAATTAAGTGTGTTCACAATAGG - Intergenic
1158606322 18:58899442-58899464 AAATTAAGTGTTTCAGAAAGAGG - Intronic
1159181987 18:64919523-64919545 ATATTCAGTGTGTTACAAATGGG + Intergenic
1162802774 19:13120109-13120131 AAACTCAGTCTGTCCCAAAGGGG - Intronic
1164269624 19:23660086-23660108 AAATTCAGTCTGTCCAAAATGGG + Intronic
1166902393 19:46075306-46075328 AAATGCAATGTGTCCTGAATAGG - Intronic
926781553 2:16477224-16477246 AAATTCAGTGTGTATCAAAAGGG + Intergenic
927942024 2:27110677-27110699 AATCCCAGTGTGTCCGGAATTGG + Intronic
929110025 2:38398398-38398420 AATCCCAGTGTGTCCGGAATTGG - Intergenic
929125457 2:38519316-38519338 AAGTTCAGTGTTTCCCAAACTGG + Intergenic
929233889 2:39586548-39586570 GAACCCAGTGTGTCCGGAATTGG - Intergenic
930180652 2:48352624-48352646 AAATTCAGTGTGTCCGAAATTGG + Intronic
930732853 2:54744746-54744768 AAACTCAGCATGTCTGAAATAGG - Intronic
935299005 2:101676540-101676562 AAATACAGTGAGTCTGAAAAGGG - Intergenic
937671252 2:124539521-124539543 ATATTCATTGTGTCCAAGATTGG - Intronic
938725851 2:134108462-134108484 TAACACAGTGTGTCCGGAATTGG + Intergenic
938748040 2:134299539-134299561 AAATGCAGTGTGTCTGAATCAGG + Intronic
939003314 2:136759665-136759687 TAAGTTAGTGTGTCCGGAATTGG - Intergenic
939903134 2:147875550-147875572 AATTTCAGTGAGTCTGGAATAGG + Intronic
939972375 2:148677576-148677598 TAAGGCAGTGTGTCCGGAATTGG + Intronic
941992644 2:171572099-171572121 AAATCCAGTGTGTCAGTAAAGGG + Intergenic
943571432 2:189580237-189580259 AAATTCAGGGTGTGGGAAAAGGG - Intronic
944891828 2:204125495-204125517 AAAATCAGGATGTCAGAAATGGG + Intergenic
945132896 2:206593508-206593530 AAATTCATTGGGTACTAAATTGG + Intronic
947150335 2:227108953-227108975 AAATTAAGGGTTTCCTAAATAGG - Intronic
947882557 2:233531468-233531490 AATTTTAGTGTGTACGTAATTGG - Intronic
1169496016 20:6116117-6116139 AATTTCATTGTGTGCGAAAATGG + Intronic
1169873365 20:10270738-10270760 TAATTCAGTTGGTCTGAAATGGG - Intronic
1169977919 20:11351615-11351637 TCATTCAGTTTGTCCTAAATGGG - Intergenic
1170102171 20:12714409-12714431 TAATTCAGTTTGTCTGAGATTGG + Intergenic
1170609715 20:17902591-17902613 GAATTCAGTGGGTCTGAAGTGGG - Intergenic
1171319161 20:24224132-24224154 TAATTCAGTGTCTCTGCAATGGG - Intergenic
1172284025 20:33728329-33728351 AAATTCAGTTTGTCAGTAAAGGG + Intergenic
1177121213 21:17139198-17139220 AAGTTCAGTGTTTCTGAAAATGG + Intergenic
1177398443 21:20568753-20568775 AAATTCAGTGTGTTCCAAGGAGG + Intergenic
1178398942 21:32266800-32266822 AGAAGCAGTGTGTCCGGAATTGG - Intergenic
1178523794 21:33307508-33307530 AAATTCAGTTTGTCGGTAAAGGG - Intergenic
1180755289 22:18156858-18156880 GAACCCAGTGTGTCCGGAATTGG - Intronic
951147678 3:19248376-19248398 AAAATCAGTGTTTCAGAAATAGG - Intronic
951658789 3:25039166-25039188 AAATGCAGAGTGTATGAAATAGG - Intergenic
952720973 3:36532343-36532365 AAATGCAATGTGTCCTAAAGTGG - Intronic
953755202 3:45640206-45640228 AAATTCAGTTTGACTGGAATAGG - Intronic
954620307 3:51991612-51991634 AATCCCAGTGTGTCCGGAATTGG - Intergenic
955476098 3:59337782-59337804 AAATGCAGTGTTTCCAAAAGTGG + Intergenic
955616816 3:60817736-60817758 AAATGCAGTGAATCCCAAATGGG - Intronic
957236606 3:77600582-77600604 AAATTCAAGGTGTGTGAAATTGG + Intronic
957510525 3:81182155-81182177 AAAAACATTGTGTCCGGAATTGG + Intergenic
958140385 3:89555113-89555135 AAATACAATGTGTAAGAAATTGG + Intergenic
960151471 3:114252948-114252970 ACATTCAGTAGGTCCGAGATGGG + Intergenic
961268961 3:125672937-125672959 AAACCCAGTGTGTCCAGAATTGG - Intergenic
961460652 3:127048027-127048049 AATCTCAGTGTGTCCAGAATTGG - Intergenic
962855977 3:139344927-139344949 AAATTTAATGTGTCCCAAATAGG - Intronic
963311308 3:143713251-143713273 AAATTCAGTGTATTCAACATTGG + Intronic
963760851 3:149285780-149285802 GATTTCATTGTGTCCGGAATTGG - Intergenic
963764032 3:149315247-149315269 AATTTCACTGTGTGCGAATTGGG + Intergenic
964636385 3:158862082-158862104 AAAATTAGTATGTCCCAAATAGG - Intergenic
965047337 3:163596786-163596808 AAATTCAAGGTGTCAGAGATGGG + Intergenic
965218366 3:165894227-165894249 AAACTCAGTATGTCCAAAATCGG + Intergenic
965479851 3:169204875-169204897 ACATTGAGTGTGACCCAAATAGG + Intronic
965678267 3:171222755-171222777 AAATTCAGTAAGACAGAAATAGG + Intronic
965960283 3:174421365-174421387 AATAACAGTGTGTCCCAAATAGG - Intergenic
966656121 3:182360458-182360480 ACATTCAGTGATTCTGAAATAGG - Intergenic
970879801 4:20915586-20915608 AAATTCAGTATGTCCTAGAGTGG - Intronic
971913054 4:32821526-32821548 AACTTCACTGTGTCCCAAAATGG - Intergenic
973860207 4:55056661-55056683 AAATTCAGTGTGGCTTAACTGGG + Intergenic
974147900 4:57968689-57968711 AATCTAAGTGTGTCCAAAATTGG - Intergenic
975353368 4:73370460-73370482 GAAGTCAGTATGTCTGAAATAGG - Intergenic
976551898 4:86406278-86406300 TAATTCAGTGAGTCTGCAATAGG - Intronic
977303091 4:95290515-95290537 AGATTCAGTGTTTCCTAAACAGG + Intronic
977555095 4:98480431-98480453 AAATTCAGTGGTTCTTAAATGGG + Intronic
979678421 4:123434364-123434386 GATGCCAGTGTGTCCGAAATTGG + Intergenic
981455105 4:144944544-144944566 AAGTTCATTGTGGCCAAAATTGG - Intergenic
981737165 4:147964783-147964805 AATTTCAGTGTGGCTGCAATCGG - Intronic
981952504 4:150426185-150426207 AAATTTAGTTTGTCCTAATTTGG + Intronic
983876392 4:172881246-172881268 AAATTCAGTGGGTGAAAAATGGG + Intronic
984387964 4:179088156-179088178 TAATTCAGTGTTTCTTAAATGGG - Intergenic
988500374 5:31778735-31778757 AATCCCAGTGTGTCCGGAATTGG - Intronic
990729228 5:58790134-58790156 AAACTCAGCATGTCCAAAATAGG + Intronic
990872708 5:60450412-60450434 GAATTCAGTTTGTCCAAACTAGG - Intronic
992947616 5:81824795-81824817 GAACCCAGTGTGTCCGGAATTGG - Intergenic
993529007 5:89002740-89002762 GAAACCAGTGTGTCCGGAATTGG + Intergenic
994963270 5:106632714-106632736 AAATTCAGTTTGTCCCCATTAGG - Intergenic
998386759 5:141761641-141761663 AAATTCACTGTGTCCGGGAAAGG + Intergenic
999934084 5:156466194-156466216 AAATTCAGTGTTTCCTTAACTGG + Intronic
1000436625 5:161218596-161218618 AAAGCCAGTGTGGCTGAAATGGG + Intergenic
1001767576 5:174263505-174263527 AAATCCAGTTTGTCAGTAATGGG + Intergenic
1003737064 6:8888255-8888277 AAGGTTAGTGTGTCCGGAATTGG - Intergenic
1003748221 6:9025663-9025685 AAATTAAATGTGTCCGGAATTGG - Intergenic
1007848311 6:44779522-44779544 AAATTCAGGGTGTGTGACATTGG + Intergenic
1010986767 6:82433946-82433968 AAAATCACTGTATCTGAAATAGG + Intergenic
1011425600 6:87226078-87226100 AAATTCAGTGTGACTATAATAGG - Intronic
1012555670 6:100508252-100508274 AATTTAAGTGTTTCTGAAATTGG - Exonic
1013402955 6:109816430-109816452 AAATGAAATGTGTCCCAAATGGG + Intronic
1013751546 6:113412837-113412859 AAACTCAGTGACTCTGAAATTGG - Intergenic
1014757366 6:125316342-125316364 AAATTCACTATGACCTAAATTGG + Intergenic
1014941862 6:127450212-127450234 AAATTCACTTTGTCCTAAATCGG + Exonic
1015515925 6:134082498-134082520 AAATTCAGTTTGTCGGTAAAGGG + Intergenic
1015853717 6:137601433-137601455 AAATTCAGTATTTCAGAAATAGG - Intergenic
1016013759 6:139163956-139163978 TAAATCAGTGGGTCCTAAATAGG + Intronic
1017017688 6:150115160-150115182 AATCCCAGTGTGTCCGGAATTGG + Intergenic
1019944068 7:4312947-4312969 AATCCCAGTGTGTCCGGAATTGG + Intergenic
1021513613 7:21460138-21460160 AAAGATAGTGTGTCCGGAATTGG + Intronic
1021800020 7:24295776-24295798 AAGTTCAGTATGTCCAAAATTGG + Intergenic
1022733605 7:33055538-33055560 AAATTCAGCTTGACTGAAATAGG + Intronic
1023594882 7:41818286-41818308 AAATTCTGAGTGTCTAAAATAGG - Intergenic
1025242797 7:57291889-57291911 AGATTCAGTGTGATGGAAATAGG - Intergenic
1027769113 7:82384241-82384263 AACTCCAGTGTGTCCGTATTTGG + Intronic
1027770190 7:82396958-82396980 CAATTCACAGTGTCAGAAATTGG - Intronic
1029868296 7:103660160-103660182 AAATACATTGTGTCAAAAATGGG + Intronic
1037701410 8:21277885-21277907 AAATGCAATGAGTCCCAAATAGG - Intergenic
1039097683 8:33904198-33904220 AAATTAAGGGTATCTGAAATGGG + Intergenic
1040550771 8:48435646-48435668 AACTTCAGTGTGTCCAACTTTGG + Intergenic
1040779390 8:51090003-51090025 GAATTCAGTTTTTCCAAAATAGG + Intergenic
1044143258 8:88680884-88680906 AAATCCAGTCTCTCAGAAATGGG + Intergenic
1044405088 8:91817717-91817739 AAACCCGGTGTGTCCGGAATTGG - Intergenic
1045198623 8:99955977-99955999 GAAGACAGTGTGTCCGGAATTGG + Intergenic
1046690095 8:117273977-117273999 AAATTCAGTGTATAGGGAATTGG - Intergenic
1048729000 8:137417088-137417110 AAATACATTGTGTCTGAAGTTGG - Intergenic
1051197042 9:14573608-14573630 AAATTTCTTGTGTCTGAAATAGG + Intergenic
1051895745 9:21986829-21986851 AAATTCAAAGTGTCCGATGTTGG + Intronic
1052075641 9:24136301-24136323 AGAGACAGTGTGTCCGGAATTGG - Intergenic
1052144597 9:25033086-25033108 AAATACAGTGAGTCCCAAACAGG + Intergenic
1052445052 9:28550073-28550095 AAATTCAATGTGTCTAAATTTGG + Intronic
1058070071 9:100592663-100592685 CAATTCAGTGTGTCCACAACAGG - Intergenic
1059991373 9:119869335-119869357 GAACCCAGTGTGTCCGGAATTGG + Intergenic
1203689850 Un_GL000214v1:31872-31894 AATTTGACTGTGTCCAAAATGGG + Intergenic
1203646425 Un_KI270751v1:72181-72203 AATTTGACTGTGTCCAAAATGGG - Intergenic
1186332155 X:8545906-8545928 CAACTCAGTGTGTCCACAATTGG + Intronic
1187424810 X:19167454-19167476 AAATTCAATGTACCCGCAATAGG - Intergenic
1188064387 X:25640354-25640376 AGATTCTTTGTGACCGAAATAGG - Intergenic
1188573404 X:31617000-31617022 AAATTCAGTATGACCCAAATAGG - Intronic
1193459438 X:81773114-81773136 CTATTCAGTGTTTCCTAAATTGG - Intergenic
1194197521 X:90914031-90914053 TAAGGTAGTGTGTCCGAAATTGG + Intergenic
1195896145 X:109747987-109748009 CAACTAAGTGTGTCCGGAATTGG + Intergenic
1197069515 X:122279288-122279310 GAATTCAGTGAGTCCGAACTTGG + Intergenic
1198453688 X:136793996-136794018 AAACTCAGTATGACCCAAATTGG + Intergenic
1200544204 Y:4498777-4498799 TAAGGTAGTGTGTCCGAAATTGG - Intergenic