ID: 930182731

View in Genome Browser
Species Human (GRCh38)
Location 2:48380426-48380448
Sequence GTGCCCAGAAGTAAATCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930182731_930182732 1 Left 930182731 2:48380426-48380448 CCAGCAGATTTACTTCTGGGCAC 0: 1
1: 0
2: 0
3: 18
4: 232
Right 930182732 2:48380450-48380472 TACCCAAAAGAATTGAAAGCAGG 0: 81
1: 453
2: 957
3: 1411
4: 1697
930182731_930182735 13 Left 930182731 2:48380426-48380448 CCAGCAGATTTACTTCTGGGCAC 0: 1
1: 0
2: 0
3: 18
4: 232
Right 930182735 2:48380462-48380484 TTGAAAGCAGGTTCTCAAAGAGG 0: 1
1: 6
2: 27
3: 113
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930182731 Original CRISPR GTGCCCAGAAGTAAATCTGC TGG (reversed) Intergenic
902150887 1:14442532-14442554 GTGCCCAGAAGTAGCTCTGTGGG + Intergenic
902252226 1:15161557-15161579 GCACCCAGAAGTGAAACTGCTGG - Intronic
902779239 1:18693744-18693766 GTGCCCAGGAGAACAGCTGCAGG - Intronic
905607480 1:39315620-39315642 GCGCTCAGAACTGAATCTGCTGG + Exonic
907272608 1:53299633-53299655 GTGCCCAGCAGAAGGTCTGCAGG + Intronic
907701758 1:56795490-56795512 GTTCCCAGAAGTGAAATTGCTGG + Intronic
910397396 1:86806328-86806350 GGGCCCTGAACAAAATCTGCAGG - Intergenic
911197441 1:95009162-95009184 ATGCCTAGGAGTAAATTTGCTGG + Intronic
911262663 1:95704931-95704953 ATGCCCAGAAGTAAGATTGCTGG + Intergenic
911897958 1:103463176-103463198 GTGCCCAGAAGTAGGATTGCTGG - Intergenic
913405522 1:118486590-118486612 GGGCCCAGCAGTAACTCTGATGG - Intergenic
914991854 1:152505573-152505595 GTGCACAGACCAAAATCTGCAGG - Intergenic
915897557 1:159823635-159823657 GTGCACAGGAGTAAATTAGCTGG - Intergenic
916926094 1:169522196-169522218 CTGCCCAAAAAGAAATCTGCAGG + Intronic
917844882 1:179012210-179012232 ATTCCCAGGAGTAAAACTGCTGG - Intergenic
918488414 1:185054092-185054114 GTGTCTAGAAGTGAAACTGCCGG + Intronic
918960059 1:191263142-191263164 ATGCCCAGAAATACAACTGCTGG + Intergenic
919420110 1:197359608-197359630 ATGCCCAGGAGTAAAATTGCTGG + Intronic
920289542 1:204909096-204909118 ATGCCCAGAGGTATATTTGCTGG + Intronic
921128065 1:212195662-212195684 GTGCCCAGTGGGAACTCTGCTGG - Intergenic
921409439 1:214819398-214819420 ATGCCCAGAAGTGACACTGCTGG + Intergenic
921877512 1:220215223-220215245 ATTCCCAGAAGTAAAATTGCTGG + Intronic
923294039 1:232575653-232575675 ATGCCCAGAAGTAGAATTGCTGG - Intergenic
1062933948 10:1371941-1371963 ATGCCCAGCAGTAAAATTGCTGG - Intronic
1063477182 10:6339562-6339584 ATACCCAGAAGTAGAACTGCTGG - Intergenic
1065162832 10:22940829-22940851 ATGCCCAGAAGTAAAATTTCTGG - Intronic
1065643888 10:27814517-27814539 GGGCCCAGATGTAACTCTGAAGG - Intronic
1067109318 10:43388585-43388607 GTGCACATAACTAAGTCTGCTGG - Intronic
1067239003 10:44474784-44474806 GTGGCCAGAAGAAGAACTGCTGG + Intergenic
1069088254 10:64167597-64167619 ATGTCCAGAAGTAGAGCTGCTGG + Intergenic
1070943487 10:80368349-80368371 ATGCCCAGAAGTAGAATTGCTGG + Intergenic
1071070800 10:81691214-81691236 GTGACCAGGAGTAAAACTGCTGG + Intergenic
1071150367 10:82627208-82627230 ATGCCCTGAAGAAAATGTGCTGG - Intronic
1071442292 10:85711106-85711128 ATACCCAGAAGTAAAATTGCTGG - Intronic
1071463226 10:85918146-85918168 GTGCACAGATGCAAATCTGGAGG + Intronic
1074286585 10:112103544-112103566 GTCCTCAGAATGAAATCTGCAGG - Intergenic
1075023431 10:118967442-118967464 GTGCCCAGAGGTAAGGCTGAGGG + Intergenic
1075228105 10:120647929-120647951 CTGCCCAGAAGAAAGACTGCAGG + Intergenic
1078884637 11:15488296-15488318 GTGAACAGAAGTGATTCTGCTGG + Intergenic
1081030087 11:38069047-38069069 ATACCCAGAAGTAAAATTGCTGG + Intergenic
1081225079 11:40511741-40511763 GTGCCCAGAAGCAATTCTTCTGG - Intronic
1082822717 11:57555141-57555163 CTACCCAGAAGTAGAACTGCTGG - Intronic
1083912106 11:65716072-65716094 GTGTGCAGAAGTAAAGCAGCAGG + Intronic
1086794262 11:91081131-91081153 GTGCCCAGGAGTCAATTTCCAGG + Intergenic
1087278458 11:96183939-96183961 GGACTCAGAAATAAATCTGCAGG + Intronic
1089626899 11:119756681-119756703 ATGCCCAGAAGTGAAATTGCTGG - Intergenic
1090922642 11:131220213-131220235 ATGCCCAGAAGGAAAATTGCTGG + Intergenic
1094008640 12:25783107-25783129 GTGACCAGGAGGAAACCTGCAGG - Intergenic
1094557674 12:31518017-31518039 GTTCCCAAAGGTAGATCTGCGGG + Intronic
1096105935 12:48997198-48997220 GGCCCCCGAAGTAAACCTGCGGG - Exonic
1097423797 12:59415876-59415898 CTGCCAGGAAGTAAGTCTGCAGG - Intergenic
1100092214 12:90985428-90985450 GGGCCCAGAACAAAATCTGGAGG + Intronic
1102499354 12:113340774-113340796 GAGCCCAGGAGTAAGGCTGCAGG + Intronic
1107361888 13:39627131-39627153 ATGCCCAGAAGTGAAATTGCTGG + Intergenic
1107743678 13:43482121-43482143 GTACCCAGAAGTGAAATTGCTGG - Intronic
1108833630 13:54511424-54511446 TTTTCCAGAAGTAAGTCTGCTGG + Intergenic
1109908719 13:68880681-68880703 GTTCCCACAAATAAATCTTCAGG - Intergenic
1113654125 13:112057483-112057505 GCGCCGAGAACTAAATCCGCGGG + Intergenic
1113761160 13:112847571-112847593 GAGCCCAGAAATAAACCTCCAGG - Intronic
1114126862 14:19737924-19737946 GAGCCCAGAAACAAATCCGCAGG - Intronic
1114817033 14:25971321-25971343 GGGCCTAGAAGTAAAGCTGTGGG - Intergenic
1115966501 14:38895484-38895506 ATGCCCAGAAGTAAAATTGCTGG - Intergenic
1117818469 14:59622820-59622842 GAGCCCAGAGGGAAAACTGCTGG + Intronic
1118060823 14:62135795-62135817 ATGTCCAGAAAGAAATCTGCAGG - Intergenic
1119295934 14:73533191-73533213 GTACCCAGAAGTAGAATTGCTGG - Intronic
1119299573 14:73560878-73560900 GTACCCAGAAGTAGAATTGCTGG - Intergenic
1119586165 14:75838034-75838056 ATGCCCAGAAGTTAAATTGCTGG + Intronic
1120453357 14:84699755-84699777 GTGCTCAGAATTACAGCTGCTGG - Intergenic
1121141467 14:91546203-91546225 ATGCCCAGGAGTAAAATTGCTGG - Intergenic
1121327525 14:93029873-93029895 GTGCACCGAAGACAATCTGCTGG - Intronic
1123203229 14:106687058-106687080 GTGCCCAGACATAAACCTCCAGG - Intergenic
1123570313 15:21599436-21599458 GAGCCCAGAAATAAATCCACAGG - Intergenic
1123606424 15:22034757-22034779 GAGCCCAGAAATAAATCCACAGG - Intergenic
1124389702 15:29242984-29243006 GTGCCCAGGAGTACCACTGCAGG + Intronic
1127862828 15:63008701-63008723 GTGCCCAGAAGAGAAGGTGCTGG + Intergenic
1128266774 15:66273716-66273738 ATACCCAGAAGTAAAATTGCTGG - Intergenic
1128774086 15:70306266-70306288 GTGCCCAGAAGTACGATTGCTGG + Intergenic
1128868159 15:71131677-71131699 GTTCCCAGGAGGAAATCTTCTGG - Intronic
1129206093 15:74037778-74037800 GGGCCCAGCAGCAAACCTGCAGG - Intronic
1130577483 15:85105407-85105429 TTGCCCAAAAGTCATTCTGCCGG - Intronic
1132126971 15:99236149-99236171 ATGCCCAGAAGTGAAACTGCTGG + Intronic
1202978665 15_KI270727v1_random:326530-326552 GAGCCCAGAAATAAATCCACAGG - Intergenic
1132521594 16:392697-392719 GGGCTTAGAAGTGAATCTGCAGG - Intergenic
1132565800 16:622182-622204 ATTCCCAGAAGTAGAACTGCTGG - Intronic
1145786426 17:27596946-27596968 GTGCCCTGATGAAAAACTGCTGG + Intronic
1148199124 17:45736900-45736922 ATGCCCAGAAGTACAATTGCTGG + Intergenic
1149994924 17:61401277-61401299 GCTCCCAGAAATAAATCTGGAGG - Intronic
1150676918 17:67252065-67252087 ATACCCAGAATTAAAACTGCTGG - Intergenic
1151324158 17:73368578-73368600 CTTCCCAGAAATAAATCTGTGGG + Exonic
1152401969 17:80071786-80071808 GTGCCTGGCAGGAAATCTGCAGG + Intronic
1153141646 18:1979328-1979350 GTACCCAGAAGTAAAATTGCTGG + Intergenic
1153810188 18:8745658-8745680 GTTCCCAGGAGTAGATGTGCAGG + Intronic
1155591760 18:27435479-27435501 ATGCCCAGAAGTACACCTTCTGG - Intergenic
1156335412 18:36167128-36167150 GTGCACAGAAGTAATTTTGTTGG - Exonic
1156591376 18:38492851-38492873 ATACCCAGAAGTGAATATGCTGG - Intergenic
1158368964 18:56775326-56775348 GTAGCCAGGAGTAAATTTGCAGG - Intronic
1159291283 18:66424825-66424847 GTACCCAGTAGTGAATTTGCTGG - Intergenic
1159691269 18:71491257-71491279 GTGCAAATAAGTAAAACTGCAGG + Intergenic
1162160453 19:8710691-8710713 ATGCCCAGAAGTAAAATTGCTGG - Intergenic
1166597273 19:44060880-44060902 GTGCACAGAAGTAAAACAGATGG - Intronic
1168509571 19:56963588-56963610 GTTCCCAGAAGTGGATTTGCTGG - Intergenic
1168566557 19:57429423-57429445 ATACCCAGAAGTAAAATTGCTGG + Intronic
928589443 2:32798867-32798889 ATACCCAGAAGTAAAAGTGCTGG - Intronic
930182731 2:48380426-48380448 GTGCCCAGAAGTAAATCTGCTGG - Intergenic
930446583 2:51481228-51481250 ATACCCAGAAGTAAAATTGCTGG - Intergenic
931646508 2:64426657-64426679 ATGCCCAGGAGTAGAACTGCTGG + Intergenic
931928492 2:67101659-67101681 GTTCCCAGAAGTAAAATTACAGG + Intergenic
934863538 2:97785646-97785668 GTGCCCAGGAGTGAATTTGTTGG - Intronic
935362631 2:102260316-102260338 ATGCCTAGAAGTAGAACTGCAGG - Intergenic
937355076 2:121193078-121193100 GTGCCCAGCAGGAGTTCTGCAGG - Intergenic
940041539 2:149366824-149366846 GGGCCCTGGAGAAAATCTGCAGG - Intronic
940050888 2:149463512-149463534 GTGACCAGAAGTGAAACTGCTGG - Intronic
943014227 2:182491563-182491585 ATGTCCAGAAGTAAGTATGCTGG - Intronic
943408941 2:187521449-187521471 GTACCCAGAGGTAGAACTGCTGG + Intronic
943897991 2:193392219-193392241 GTGCCATAAACTAAATCTGCAGG - Intergenic
945389892 2:209252269-209252291 ATACTCAGAAGTAAAACTGCTGG - Intergenic
945679378 2:212895154-212895176 ATGCCTAGGAGTAAAGCTGCAGG + Intergenic
946528537 2:220546620-220546642 TTGCCCAGAGATAACTCTGCTGG - Intergenic
1168751763 20:287174-287196 ATGCCCAAGAGTAAAACTGCTGG + Intronic
1169182916 20:3586029-3586051 GTACCTAGGAGTAAAACTGCTGG - Intronic
1170443362 20:16400489-16400511 GTACCCAGAAGTAGAATTGCTGG - Intronic
1174622001 20:51882725-51882747 GAGCCCAGAAATAAACCTTCAGG + Intergenic
1175188501 20:57195870-57195892 GTTTCCTGAAGTAAGTCTGCTGG - Intronic
1175705259 20:61171962-61171984 GTGCCCAGCAGCAAAGGTGCTGG - Intergenic
1175785652 20:61710231-61710253 GTGGCCAGAAGTCCCTCTGCTGG + Intronic
1176094001 20:63331278-63331300 GTGCCCAGATGTGAAGGTGCTGG - Intronic
1177916677 21:27097250-27097272 GTACTCAGAAGTAAGGCTGCTGG + Intergenic
1178291482 21:31372411-31372433 GTGCCCAGTAGGAAATATGGAGG + Intronic
1178391577 21:32202988-32203010 ATGCCCAGAAGTGGAACTGCTGG + Intergenic
1179996592 21:44977159-44977181 GTGCCCACAAGATAGTCTGCTGG + Intergenic
1183770761 22:39923785-39923807 TTTCCCAGAAGTAGAGCTGCAGG - Intronic
1183873910 22:40762710-40762732 ATACCCAGAAGTAAATTTGCTGG - Intergenic
1185214438 22:49590402-49590424 GTGGACAGAAGTAAATCTCTTGG - Intronic
1185257407 22:49842977-49842999 ATGCCCAGAAGCACAACTGCTGG - Intergenic
949498656 3:4657308-4657330 CTGCCCACAACCAAATCTGCAGG + Intronic
950386579 3:12664759-12664781 GTGTCTAGAAGTGAAACTGCCGG - Intergenic
952722758 3:36550122-36550144 GAGCCAAGAAGGAAATCTACTGG + Intergenic
952915396 3:38234719-38234741 GTGCCTAGGAGTAGAACTGCTGG - Intronic
953903322 3:46855513-46855535 ATGCCCAGAAGTACAATTGCTGG + Intergenic
954893516 3:53954980-53955002 ATACCCAGAAGTAATACTGCTGG - Intergenic
957404312 3:79757172-79757194 GTACCCAGAAGTAGAATTGCTGG + Intronic
959402019 3:105914325-105914347 GTACCCAGAAGTAAAAATTCTGG - Intergenic
959761626 3:109972821-109972843 ATACCAAGAAGTAAAACTGCTGG - Intergenic
959907357 3:111724696-111724718 GTGGCATGAACTAAATCTGCAGG - Intronic
961310211 3:125992669-125992691 ATGCCCAGAAGTAGAATTGCTGG - Intergenic
961734102 3:128989996-128990018 ATTCCAAGAAGTAAATTTGCTGG - Intronic
962565615 3:136655904-136655926 ATACCCAGAAGTAAAATTGCTGG - Intronic
963345048 3:144085955-144085977 GTTACCAGAGGTACATCTGCAGG + Intergenic
963955642 3:151250778-151250800 GTGCCCAGAAGCAAAATTGCTGG + Intronic
963970285 3:151421821-151421843 GTACCAAGAACTGAATCTGCTGG - Intronic
964854235 3:161128781-161128803 ATACCCAGAAGTAAAATTGCTGG - Intronic
964952217 3:162309844-162309866 GTACCCAGAAATAAATGTGCAGG - Intergenic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
968946423 4:3666918-3666940 GGGCCCAGCAGCAACTCTGCAGG - Intergenic
971903055 4:32687676-32687698 ATGCCCAGAAGTGAAATTGCTGG - Intergenic
974168559 4:58236193-58236215 TTACCCAGAAGTAAATTTGATGG + Intergenic
977357904 4:95969638-95969660 GTGCCCAGAAGCACATGTCCTGG + Intergenic
977367256 4:96085999-96086021 GTGCCCAGAAGTACAATTGTTGG - Intergenic
978406898 4:108389848-108389870 ATGCCCAGAAGTACAATTGCTGG - Intergenic
979165513 4:117524839-117524861 GTTTCCAGAAGAAAATCTGCAGG - Intergenic
979774811 4:124576931-124576953 ATACCCAGTAGTAAAACTGCTGG + Intergenic
981381465 4:144076820-144076842 ATGCCCAGTAGTAGAACTGCTGG + Intergenic
985209333 4:187575381-187575403 TTACCAAGAACTAAATCTGCAGG + Intergenic
985483700 5:136837-136859 GTGCCCAGAAGTGGAACTGCTGG - Intergenic
985924170 5:3002844-3002866 GGGCCCAGAAATAAATGAGCAGG - Intergenic
989377579 5:40780779-40780801 GTGGCCACCATTAAATCTGCTGG - Intronic
990707230 5:58542954-58542976 CAGCCCAGAGGTAAATCTGGTGG + Intronic
992062772 5:73072385-73072407 ATACCCAGAAGTAAAATTGCTGG - Intronic
994020854 5:95023655-95023677 GTTCCAAGAAGAAAATCAGCAGG + Intronic
994630629 5:102281885-102281907 ATGCCCAGGAGTAAAACTGCTGG - Intronic
995124419 5:108565899-108565921 GTGCCCACTAGTCACTCTGCAGG - Intergenic
995703137 5:114957899-114957921 GAGCCCAGGACTAAATCTGAGGG + Intergenic
997144036 5:131412828-131412850 GTACCCAGAAGTGGAACTGCTGG + Intergenic
997959867 5:138312177-138312199 ATACCCAGAAGTAAAATTGCTGG - Intronic
998168572 5:139858774-139858796 GTGCACAGGCGTGAATCTGCAGG - Intronic
999883635 5:155895069-155895091 GTGATCAGAAGTAAGTCTACAGG - Intronic
1000068222 5:157715362-157715384 GTACCCAGAAGTGAAATTGCAGG + Intergenic
1000668715 5:164033229-164033251 GTGACCATAAGTAATTATGCTGG + Intergenic
1000719551 5:164690146-164690168 ATACCCAGAAGTAAAATTGCTGG - Intergenic
1002762441 6:212334-212356 ATGCCCAGAAGTGGAACTGCTGG - Intergenic
1003735425 6:8872884-8872906 CTTCCCAGAAGCAAATCTTCTGG + Intergenic
1003980617 6:11386711-11386733 CTACCCAGAGGTAAATCAGCTGG - Intergenic
1004795709 6:19081212-19081234 GAGCCCATAAGCAAATCTGAAGG + Intergenic
1005002981 6:21261423-21261445 GTGTCCAGAAATAAATGTGGAGG - Intergenic
1005907193 6:30273694-30273716 AGGCCCAGAAGTAAAACTGCTGG - Intergenic
1006247581 6:32752970-32752992 GTACCCAGAAGTGGAACTGCTGG - Intergenic
1006732057 6:36243646-36243668 GAGCCCAGCAGTTAGTCTGCAGG + Intronic
1008410319 6:51171034-51171056 ATGCCCAGTAGTGAAACTGCTGG - Intergenic
1009428790 6:63543345-63543367 GTGCCAAGAAGGAAACCTGCAGG - Intronic
1010875202 6:81095423-81095445 ATACCCAGAAGTAAAACTGCAGG + Intergenic
1011190572 6:84723833-84723855 ATACCCAGAAGTAAAATTGCTGG + Intronic
1012053188 6:94370159-94370181 GTACCCAGAAGTAAACTTGCTGG - Intergenic
1012056538 6:94419437-94419459 ATGCCAAGAAGTAAGACTGCTGG + Intergenic
1013138712 6:107309229-107309251 GTGCTCAGATGAAAATGTGCAGG - Intronic
1013511451 6:110848012-110848034 GTGGCTAGAAGGAAATTTGCTGG - Intronic
1014112353 6:117633409-117633431 CTGCCTATAAGTAAATTTGCTGG + Intergenic
1017868462 6:158465506-158465528 GTGCCCAGAAGTGGACTTGCTGG + Intronic
1020458748 7:8404174-8404196 GTGCCCAGAAGTGGAATTGCTGG - Intergenic
1022147588 7:27560814-27560836 ATACCCAGAAGTAAAATTGCTGG + Intronic
1024226310 7:47328788-47328810 GGGCCCGGAAGAAAACCTGCAGG - Intronic
1026544145 7:71307148-71307170 ATGCCCAGAAGTAAAATTCCTGG + Intronic
1028704826 7:93829477-93829499 ATGCCCAGAAGTTCATTTGCTGG - Intronic
1028795532 7:94897637-94897659 GTACCTAGAAGTAAAATTGCTGG + Intergenic
1030730883 7:112987243-112987265 ATGACCAGAAGTAAAATTGCTGG + Intergenic
1032272733 7:130425631-130425653 GTGCTCAGGAGTACAACTGCTGG - Intronic
1032770353 7:135047388-135047410 ATACCCAGAAGTAAGACTGCTGG + Intronic
1033415689 7:141159429-141159451 ATGCCCAGAAGTAGAATTGCTGG - Intronic
1034798393 7:154034481-154034503 GTCCCCTGAAGCAAATCTACGGG + Intronic
1035022204 7:155806488-155806510 GTGGCCAGGAGTGAAACTGCGGG - Exonic
1035563245 8:624394-624416 GTGCCTAGGAGTAGAACTGCAGG - Intronic
1036941112 8:13053411-13053433 ATGACCAGAAGTACAACTGCTGG + Intergenic
1037059317 8:14486732-14486754 GAGCCCAGGAGTAAATTAGCTGG - Intronic
1037264829 8:17046789-17046811 GAGCCCAGGAGGAAATTTGCAGG - Intronic
1038173458 8:25160011-25160033 GTGCCTGGAAGTCACTCTGCTGG - Intergenic
1038605254 8:28995509-28995531 GTGCCTAGAAATAGAACTGCTGG + Intronic
1039665857 8:39527007-39527029 ATGCCCAGAAGTATAATTGCTGG - Intergenic
1042086259 8:65112521-65112543 CAGCCCAGAAGGAAATCTGTGGG - Intergenic
1042790989 8:72606154-72606176 ATTCCCAGAAGTAAAGCTACTGG - Intronic
1045283363 8:100769029-100769051 ATGCCCAGTAGTAGAACTGCTGG - Intergenic
1050192559 9:3043588-3043610 GTCCCCAGAATGAAGTCTGCCGG + Intergenic
1051887430 9:21908467-21908489 ATGCCCAGAAGTGAAATTGCTGG + Intronic
1052105150 9:24505502-24505524 GTCCCCAGATGTACATCTGATGG - Intergenic
1052407105 9:28075484-28075506 GTGCCCATTAGTAACTCTACTGG + Intronic
1055153326 9:73030184-73030206 ATGCCCAGAAGTAAAATTGTTGG + Intronic
1056940099 9:90947952-90947974 ATACCCAGAGGTAAATGTGCTGG - Intergenic
1057385041 9:94599385-94599407 GTGCCCAGAGGTGGACCTGCAGG + Intergenic
1057842565 9:98497861-98497883 GTGCCCAGAAGTGGAATTGCTGG - Intronic
1059213341 9:112535592-112535614 ATGCCCAGAAGTAGAATTGCTGG + Intronic
1060243094 9:121921619-121921641 GTACACAGAAATAAATCAGCAGG - Intronic
1061305609 9:129731301-129731323 GTTTCTAGAAGTAAAACTGCTGG - Intergenic
1062673676 9:137726632-137726654 GTGCCCAGCAGTGGAACTGCTGG + Intronic
1062675133 9:137738521-137738543 GTGCCCAGCAGTGGAACTGCTGG - Intronic
1185749012 X:2595449-2595471 GTGCCCAGAAGCAGAATTGCTGG - Intergenic
1185887242 X:3793669-3793691 GTGACCTGAAATAAAGCTGCAGG + Intergenic
1185966599 X:4613013-4613035 GTTCACAGAAGTAAATGTGAAGG + Intergenic
1187457202 X:19452471-19452493 ATGCCCAGAAGTAAAATTGTTGG - Intronic
1187925461 X:24245640-24245662 GTACCCAGGAGTAAAACTGATGG + Intergenic
1188411602 X:29878879-29878901 ATGCCCAGAAGTAAGGTTGCTGG - Intronic
1188990178 X:36809289-36809311 GTACCCAGAAGTAGAATTGCTGG + Intergenic
1189190299 X:39095766-39095788 GTACCCAGAAATAAAATTGCTGG - Intergenic
1190531359 X:51380847-51380869 ATACCCAGAAGTAAAATTGCAGG - Intergenic
1191989837 X:67022646-67022668 GTACCCAGAAGTAGAATTGCTGG + Intergenic
1193289614 X:79756196-79756218 GTCCCCAGAAGCAAATTTGAGGG - Intergenic
1194036511 X:88880446-88880468 ATGCCCAGAAGTAGAACTGGTGG + Intergenic
1195901549 X:109802998-109803020 CTGCCCAGGAGTAAAATTGCTGG - Intergenic
1196775871 X:119336717-119336739 ATGCTTAGAAGTAAATTTGCTGG - Intergenic
1198278808 X:135122210-135122232 GTGGCCAGGAGAAAACCTGCGGG - Intergenic
1198292152 X:135250306-135250328 GTGGCCAGGAGAAAACCTGCGGG + Intronic
1200217128 X:154372915-154372937 CTGCCCCGAAGTGAATGTGCTGG - Intronic
1200775089 Y:7163462-7163484 GTGACCTGAAATAAAGCTGCAGG - Intergenic
1200801004 Y:7387053-7387075 GTGCCCTGAACAAAATCTGGAGG - Intergenic