ID: 930187180

View in Genome Browser
Species Human (GRCh38)
Location 2:48421722-48421744
Sequence ATAATGTTTTTGATGAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930187180_930187184 -5 Left 930187180 2:48421722-48421744 CCTTATTTCATCAAAAACATTAT No data
Right 930187184 2:48421740-48421762 ATTATGTAGGCTGGGCGCCGTGG No data
930187180_930187186 22 Left 930187180 2:48421722-48421744 CCTTATTTCATCAAAAACATTAT No data
Right 930187186 2:48421767-48421789 CGCCTGTAATCCCAGCACTTCGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
930187180_930187187 23 Left 930187180 2:48421722-48421744 CCTTATTTCATCAAAAACATTAT No data
Right 930187187 2:48421768-48421790 GCCTGTAATCCCAGCACTTCGGG 0: 4742
1: 224904
2: 276751
3: 269024
4: 314877

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930187180 Original CRISPR ATAATGTTTTTGATGAAATA AGG (reversed) Intergenic
No off target data available for this crispr