ID: 930191593

View in Genome Browser
Species Human (GRCh38)
Location 2:48465723-48465745
Sequence TGTCCTTTGCAGTACTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 17, 3: 60, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930191593_930191598 25 Left 930191593 2:48465723-48465745 CCATCCAAGTACTGCAAAGGACA 0: 1
1: 0
2: 17
3: 60
4: 209
Right 930191598 2:48465771-48465793 TTTACTCTCAAAATAAAATATGG 0: 1
1: 0
2: 6
3: 53
4: 686

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930191593 Original CRISPR TGTCCTTTGCAGTACTTGGA TGG (reversed) Intronic
901231788 1:7645736-7645758 TGTCCTCTGCAGCACTGGGCGGG + Intronic
904227288 1:29033081-29033103 TTTCTTTTTCAGGACTTGGAAGG + Exonic
906020290 1:42622240-42622262 TGTCATTTGCAATACATGGATGG - Intronic
906283294 1:44568586-44568608 ACTCCTTTGCAGGATTTGGAAGG + Intronic
906359994 1:45147394-45147416 TTTCCTTTGTGGTAATTGGAGGG - Intronic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
910665629 1:89723244-89723266 TCTCCCTTACAGTCCTTGGAAGG - Intronic
910889557 1:92002999-92003021 TGTCCTCTAAAGTACTTGCAAGG - Intronic
910906623 1:92188337-92188359 TGTAATTTGGAGTGCTTGGATGG + Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
913343434 1:117783158-117783180 TGTCATTTGCAGGAGTGGGAAGG + Intergenic
914994258 1:152527576-152527598 TGTCTTTTACAGAACATGGATGG - Intronic
916247286 1:162701327-162701349 TGGCATTTGCAGTAAATGGAAGG + Intronic
917104897 1:171482680-171482702 TCTCCTTAGCAGCACTTGGATGG - Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
923076361 1:230612350-230612372 TTTCCTTTGAAGTAGTTGGTTGG + Intergenic
1064532532 10:16324824-16324846 TTTTCTTTTCAGCACTTGGATGG + Intergenic
1065602083 10:27379215-27379237 TGTCCTTTGCAGCAATGTGATGG - Intergenic
1065700014 10:28415732-28415754 TGTCTTTTGCGGAACATGGATGG - Intergenic
1067149142 10:43715313-43715335 TGTGCTTTTCAGTACCTGGCAGG - Intergenic
1070053985 10:72916476-72916498 TGTCCTTTGCAGGGAGTGGATGG - Intronic
1070949346 10:80418554-80418576 TCTCCCTTGCAGGACTTGGCCGG - Intronic
1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG + Intergenic
1075187598 10:120277033-120277055 TGTCCTTTGAAGGACATGGATGG + Intergenic
1077387949 11:2282265-2282287 TATGCAATGCAGTACTTGGAGGG + Intergenic
1078100488 11:8327717-8327739 TGTCCTCAGCGGCACTTGGATGG + Intergenic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079920324 11:26425845-26425867 TGTACTTTGGAGTAAATGGATGG + Intronic
1082904093 11:58287185-58287207 TGTCTTTTGCAGAACATAGATGG + Intergenic
1083919649 11:65775433-65775455 TGTCCTTTGAAGGATATGGATGG + Intergenic
1084817730 11:71659604-71659626 TGTCGTTTCCTGTACTAGGAAGG + Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1087585311 11:100112035-100112057 TATCCTTTCCAGCACATGGAGGG + Intronic
1089144038 11:116311319-116311341 TGTCCTTTTCAGACCATGGAGGG - Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1092791775 12:12076582-12076604 TGCCCTTTGCTGCACTGGGAGGG + Intronic
1093689307 12:22091559-22091581 TCTCCTTTGCCTTACTCGGATGG + Intronic
1094128782 12:27052393-27052415 TTTCCTTTGAAGTATTTTGAAGG + Intronic
1097538359 12:60902502-60902524 TGTCATTTGCAACACATGGATGG + Intergenic
1099186883 12:79524807-79524829 TGTCATTTGCATTATTTGGATGG - Intergenic
1099302524 12:80915711-80915733 TGTGCTTTGCAGCAACTGGATGG + Intronic
1099820889 12:87708125-87708147 TTTGCTTTGCTGTAGTTGGATGG - Intergenic
1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG + Intronic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1107458003 13:40572870-40572892 TGTCTTTTGTATTACTTAGAAGG - Intronic
1108738978 13:53314998-53315020 TGTCTTTTGCAGAACTTGGGTGG + Intergenic
1110098287 13:71560425-71560447 TGTCCAGAGCAGTACTAGGATGG - Intronic
1110290400 13:73799099-73799121 CGTCTTTTGCAGCACATGGATGG + Intronic
1110887791 13:80659523-80659545 TGTCTTTTGCGCAACTTGGATGG - Intergenic
1110972907 13:81788854-81788876 AGTCATTTGCAGAACGTGGATGG - Intergenic
1111710651 13:91808724-91808746 TGTCCTAAGCAGTAGTTTGAAGG - Intronic
1112670868 13:101636676-101636698 TGTGCTTTGCAGAAGTGGGAAGG + Intronic
1113747124 13:112752914-112752936 TGTCCTTTGGAGTTAATGGAGGG + Intronic
1114333545 14:21663140-21663162 TATCCTTTGCAGCACTTAGTAGG - Intergenic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115159151 14:30373571-30373593 TGTTCTTTGAAGTACTTAGGAGG - Intergenic
1115329079 14:32174669-32174691 TGTCTTTTGCAGCATGTGGATGG - Intergenic
1115764714 14:36611837-36611859 TGTTTTTTGCAGGACATGGATGG + Intergenic
1116035544 14:39622798-39622820 TGTCCTTGGCAGGACATGGATGG - Intergenic
1116942370 14:50803414-50803436 TGTCCTCTGCATTATTTGGCTGG - Intronic
1116943687 14:50816036-50816058 TGTCCTTTGCAAGACATAGATGG + Intronic
1117842462 14:59873976-59873998 TGTCATTTGCACAACATGGATGG - Intergenic
1118504815 14:66399692-66399714 TGTCCTTAGCAGTTCTAGGGTGG - Intergenic
1119583492 14:75809869-75809891 TGTCATTTGCAGAACATAGATGG - Intronic
1120058955 14:79959374-79959396 TGTCCTTTGAGGGACATGGATGG + Intergenic
1122198320 14:100106577-100106599 TCTCCTTTGCAGTACATGTAAGG + Intronic
1123753388 15:23376317-23376339 TGTCCTAAGCAGTAGTTTGAAGG + Intergenic
1124137744 15:27049595-27049617 TGTCATGTTCAGTACTTGGGAGG - Intronic
1124346511 15:28925638-28925660 TGTATTTTGCTGTAGTTGGATGG + Intronic
1125766267 15:42138522-42138544 TATCCTTTCCATTCCTTGGATGG - Intergenic
1126828426 15:52574451-52574473 TGTCATTTGCAGCAACTGGATGG - Intergenic
1127335282 15:57978648-57978670 GTCCCTGTGCAGTACTTGGAGGG + Intronic
1128427068 15:67552730-67552752 TGTCCTTTTAAGTACTTCGTGGG - Intronic
1129523135 15:76198295-76198317 TGTGCTGTGCAGTCCGTGGAGGG - Intronic
1130109310 15:80951670-80951692 TGTCCTTTGCATTGCTTGGAAGG + Exonic
1130181045 15:81628909-81628931 TGTCCTTTGCAGGGCGCGGATGG + Intergenic
1132245293 15:100291679-100291701 TGTCCTCTGCAGCACATGGATGG + Intronic
1132700413 16:1219880-1219902 TGGCCTCTCCAGTACCTGGATGG + Intronic
1136061594 16:27730423-27730445 TCTCATTTGCAGTACTTGTCTGG + Intronic
1139692393 16:68649641-68649663 GTCCCTGTGCAGTACTTGGAGGG + Intronic
1141260244 16:82446909-82446931 TGGCATTTGCAGCACCTGGATGG + Intergenic
1141767657 16:86069642-86069664 TGTCCTTTGCAGTGATTGTCTGG + Intergenic
1145939650 17:28736077-28736099 TGTCCTTTGTAGGACATGGATGG - Intronic
1146732345 17:35204599-35204621 TATCCTGTGCATGACTTGGAGGG - Intergenic
1148173556 17:45544782-45544804 TTTCCTTCCCAGTACTTAGAGGG - Intergenic
1148214092 17:45825065-45825087 TTTCCTCTGCAGTTCTGGGAGGG - Intronic
1148275714 17:46300667-46300689 TTTCCTTCCCAGTACTTAGAGGG + Intronic
1148362374 17:47022725-47022747 TTTCCTTCCCAGTACTTAGAGGG + Intronic
1149283914 17:55140483-55140505 AATCCTTAGCAGTACTTGGATGG + Intronic
1150783842 17:68146552-68146574 TTTCCTTCCCAGTACTTAGAGGG - Intergenic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG + Intronic
1153837250 18:8974975-8974997 TGTCATTTGCAAAACATGGATGG + Intergenic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1154437289 18:14356918-14356940 GGCCCTGTGCAGTACTTGGCAGG + Intergenic
1156715364 18:40002561-40002583 TGTATTTTGCAGAACATGGATGG + Intergenic
1157182098 18:45507019-45507041 TGTCCTTTCCTGTACATTGAAGG + Intronic
1159065184 18:63561728-63561750 TGTCCTTTGCAGTAACATGATGG + Intronic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1162385350 19:10357700-10357722 TGTCCTCTGGATTTCTTGGAGGG + Intronic
1167243215 19:48357765-48357787 TGTCTCTTGCAGTAATTGGATGG + Intronic
927085124 2:19667536-19667558 TGTCTTTTGCAGGCCTTGAATGG + Intergenic
930191593 2:48465723-48465745 TGTCCTTTGCAGTACTTGGATGG - Intronic
931502148 2:62881080-62881102 TGTTCTTTGCAGCACATGGATGG + Intronic
931779762 2:65568808-65568830 TGGCCTTTGCAGCACATGGGTGG - Intergenic
932482125 2:72049865-72049887 TGTCTTTTGCTATAGTTGGATGG - Intergenic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
933416195 2:81989478-81989500 TGTCCTTTCCTATACCTGGAAGG - Intergenic
935103912 2:100021972-100021994 TGTCCTCCGCAGTACTTGTGTGG - Intronic
936849434 2:116877766-116877788 TGCCCTTTGCAGTTCTTCGCAGG + Intergenic
937287064 2:120760392-120760414 TGTCCCTTCCAGTCCTGGGAAGG - Intronic
937464304 2:122116921-122116943 TGTCATTTTCAGCACATGGATGG - Intergenic
937735966 2:125289750-125289772 TGTCCTTTGCGGGACATGGATGG - Intergenic
939729169 2:145760349-145760371 TGTACTTTTCAGAACTTTGAAGG - Intergenic
940722942 2:157301546-157301568 TCTTCTTTCCAGTGCTTGGATGG - Intronic
940974137 2:159924665-159924687 TTTCCTTAGCAGTACTTGCATGG - Intergenic
941389639 2:164895692-164895714 TGGCCTTGTTAGTACTTGGATGG - Intergenic
942705655 2:178769074-178769096 TGTCCTGTATAGTACATGGAAGG - Intronic
944360815 2:198854115-198854137 TGTCCTTTGCAGTAACATGATGG + Intergenic
945377472 2:209096304-209096326 TGCTCTTTGCAGAACATGGATGG - Intergenic
945720956 2:213417993-213418015 TGTAATTTCCACTACTTGGAAGG - Intronic
947279600 2:228435552-228435574 TGTCTTATGCAGTATTTGCATGG - Intergenic
947952225 2:234158200-234158222 TGTCCTATGAGGTGCTTGGATGG + Intergenic
1169527059 20:6440689-6440711 TCTCCTTTGCAGCGCTGGGACGG - Intergenic
1170743213 20:19075762-19075784 TCTCCTTTGCAATGCCTGGAAGG + Intergenic
1173887968 20:46478676-46478698 GGTCCATTGCAGTGGTTGGAGGG + Intergenic
1173936349 20:46869353-46869375 TGTCTTTTGAATTACTTGCAAGG + Intergenic
1174616710 20:51841113-51841135 TGTCTTCTGCAGTTCTTGGCAGG - Intergenic
1176839763 21:13828720-13828742 GGCCCTGTGCAGTACTTGGCAGG - Intergenic
1178432951 21:32532496-32532518 TGCCCTTTTCTGTGCTTGGATGG + Intergenic
1183587672 22:38762449-38762471 TGTCCTGGGCAGGACTTGGGTGG - Intronic
1184771077 22:46596922-46596944 ACTCCTTTGCAGAGCTTGGATGG + Intronic
1184978318 22:48078859-48078881 TTTCCTTTGTTGTGCTTGGAGGG + Intergenic
951755448 3:26086445-26086467 TGTCCTTTGCAGTGAAAGGATGG - Intergenic
953549123 3:43886821-43886843 TGTCTTTTGGAGTACTGGAATGG - Intergenic
954735819 3:52705871-52705893 TGTCCTTGACAGTACTTGCGCGG - Exonic
954831735 3:53426797-53426819 TGTCCCTTGCAGAAACTGGATGG - Intergenic
955166077 3:56512509-56512531 TTTCCTTTGAAATACTTGGAGGG - Intergenic
956433302 3:69208761-69208783 TTTCCTTTGAAGTCTTTGGAGGG - Intronic
958023462 3:88023885-88023907 TGTCATTTGCAGCAACTGGATGG + Intergenic
958160377 3:89811412-89811434 TGTCCTGGGAAGCACTTGGATGG + Intergenic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
960113222 3:113866047-113866069 TGTATTTTGCAGTTGTTGGATGG + Intronic
962089391 3:132227327-132227349 TGTCCTTTGCAGGGAATGGAGGG - Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
965993851 3:174854218-174854240 TATCTTTTGCAGTACATGGATGG + Intronic
966654800 3:182343833-182343855 TGTTCTTTGCAGCACATGGATGG - Intergenic
967787605 3:193514384-193514406 TGTCCTTTTCAGGACATGGATGG - Intronic
968909271 4:3469360-3469382 AGGCTTTTGCAGAACTTGGAGGG - Intronic
969082570 4:4630667-4630689 TGTCCCCTGCAGGACATGGATGG + Intergenic
969544260 4:7814054-7814076 TTTCCTTAGCAGTATGTGGACGG - Intronic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
972213176 4:36863092-36863114 TGTCTTTTGCACAACTTGGATGG + Intergenic
972312830 4:37896669-37896691 GGTTCTCTGCAGCACTTGGATGG + Intronic
972910663 4:43812649-43812671 TGTCCTTTGCAGAGCGTGGATGG + Intergenic
972984854 4:44750733-44750755 TGTCCTTTCCGGGACATGGATGG - Intergenic
973734504 4:53857090-53857112 TGTCCTTTGAAGTGATTGGGTGG - Intronic
974392200 4:61285889-61285911 TCTCCTTTGCATGAGTTGGAGGG - Intronic
976404418 4:84646119-84646141 TTTCCTTCATAGTACTTGGAAGG + Intronic
976793270 4:88904456-88904478 TGTCCTTTCTAGGACATGGATGG + Intronic
977520153 4:98072248-98072270 TGTCCTTTGCGGGACATGAATGG + Intronic
978000560 4:103552815-103552837 TGTCCTCTGGAGTATTTTGATGG - Intergenic
978369991 4:108020346-108020368 TGTAGTCTCCAGTACTTGGAAGG + Intronic
979300801 4:119085124-119085146 TGTCTTTTGCAGTAAATGGTTGG + Intergenic
980282758 4:130741797-130741819 TATCCTTTGGAGAACATGGATGG - Intergenic
980857486 4:138456601-138456623 TGTGCTGTGCAGGACATGGATGG + Intergenic
981453302 4:144924417-144924439 TGTCATTTGCAATAACTGGATGG - Intergenic
983155620 4:164344063-164344085 TGTCCTTTGCACAGCATGGATGG + Intronic
983462341 4:168043008-168043030 TGTACTTTGCAGCACTTGGATGG + Intergenic
984628016 4:182030384-182030406 TGTCTTTTGCAGGACAGGGATGG - Intergenic
985422856 4:189801917-189801939 TTTTCTTTACAGCACTTGGAAGG - Intergenic
988492396 5:31716181-31716203 TGTACTTTGCACTGCTTGGAAGG + Intronic
989858788 5:46338023-46338045 TGTACATTGGAGCACTTGGAAGG - Intergenic
990202505 5:53393195-53393217 TGTATTTTGCTGTAGTTGGATGG - Intergenic
990797039 5:59555188-59555210 TGTCCTCTGCAAAACGTGGATGG + Intronic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993247684 5:85471655-85471677 TGTCCTTTGCAAAACATGGATGG + Intergenic
993568689 5:89508562-89508584 TGTCTTTTGCGGAACATGGATGG + Intergenic
993795118 5:92257490-92257512 TGTCCTTTGCAGCATACGGATGG + Intergenic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
994541134 5:101099152-101099174 TGTCTTTTGCAGCATTTGAATGG + Intergenic
994543291 5:101128142-101128164 CGTCCTTTGCAGGGCATGGATGG + Intergenic
995059044 5:107794179-107794201 TGTCCTTTGCAAAACATGGATGG + Intergenic
995155742 5:108910792-108910814 TGTCCTTTGCAGCAACTAGATGG - Intronic
995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG + Intronic
995621904 5:114034868-114034890 TGTTCTTTGCAGAACATGGATGG - Intergenic
996795853 5:127345998-127346020 TGACATTTGCAGCACCTGGATGG - Intronic
997334629 5:133098213-133098235 TGTCTTTTGCAGCAACTGGATGG - Intronic
997785989 5:136714456-136714478 TGTCCTTTGCAGAAAATGGATGG - Intergenic
998046909 5:138995012-138995034 TGTCCTTTGCAGGACATGAATGG - Intronic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
1000189600 5:158897255-158897277 TGTCCTTTGCGGGACATGGATGG + Intronic
1000563590 5:162821171-162821193 TGTTCTTTGCATTGCTTGAAGGG - Intergenic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1002069790 5:176672338-176672360 TGTCCTCTGCAGGACCTGCAGGG - Intergenic
1002450295 5:179314837-179314859 TGTCCCTTGCAGCTCTTGGTTGG - Intronic
1002967748 6:1984058-1984080 TGTCCTTTGTGGGACATGGATGG + Intronic
1003945080 6:11067730-11067752 TCTCCTTTCTAGTACTTGGAGGG + Intergenic
1005405360 6:25481611-25481633 TGCTCATTGCAGTCCTTGGATGG + Intronic
1005919240 6:30384100-30384122 TGTCCTTTGCGGAACATGGATGG - Intergenic
1008098064 6:47360470-47360492 TGTCTTTTGAAGGAATTGGAAGG - Intergenic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1008323558 6:50148449-50148471 TGTCCATTGCTGTCCTGGGAGGG - Intergenic
1008670403 6:53762290-53762312 CGTCTTTTGCAGCACTTGGATGG - Intergenic
1011096544 6:83672302-83672324 TGTCCTTTGCCTTACTTGCATGG - Intronic
1012949789 6:105505566-105505588 TGTCCTTTAAAATACTTGGAGGG - Intergenic
1013508628 6:110824260-110824282 TGTCTTTTGAGGAACTTGGATGG + Intronic
1013896723 6:115097553-115097575 TGTCCTCTGCAGGACGTGAACGG - Intergenic
1014012775 6:116495317-116495339 TGTCATTTGCAAAACATGGATGG - Intronic
1014375300 6:120664774-120664796 TGTCCTTTGCAGGGCATGGATGG - Intergenic
1014477712 6:121894924-121894946 TGTACTTTCTAGTGCTTGGAGGG + Intergenic
1016468489 6:144349693-144349715 TTTCCTTGGCATTACTTGAAAGG + Intronic
1019098427 6:169607465-169607487 TGTCTTTTGCAGCACATGGATGG + Intronic
1021364247 7:19756750-19756772 GGTCTTTTGCAGGACATGGATGG - Intronic
1022211744 7:28217514-28217536 TGTCCTTTGGAGTACTTCTTGGG + Intergenic
1026889922 7:73975888-73975910 TGTCCTTAGCTGTCCTGGGAAGG - Intergenic
1027375015 7:77539497-77539519 TGTCATTTACAGCAATTGGATGG + Intronic
1030803310 7:113881338-113881360 TATCCTTTACTGTATTTGGATGG - Intronic
1032081547 7:128861002-128861024 TGGCCTGTGCAGCACATGGATGG - Intergenic
1032962267 7:137050053-137050075 TGTCATTTGCACCATTTGGAAGG - Intergenic
1033745850 7:144316637-144316659 TGTCCTTTGATGGACATGGATGG - Intergenic
1034073087 7:148206812-148206834 TGCTGTTTCCAGTACTTGGAGGG + Intronic
1034999866 7:155604060-155604082 CCTCCCTTGCAGTATTTGGACGG - Intergenic
1036106949 8:5851471-5851493 TGTCTTTTGCACAATTTGGATGG + Intergenic
1036585698 8:10121412-10121434 TTTCTTTTGCAGTGCTTGGCAGG + Intronic
1037226665 8:16600799-16600821 TGTCCTTTGCATTAATAGAAAGG - Intergenic
1037702929 8:21291252-21291274 TGTCGTTGGCTGTACTTAGATGG - Intergenic
1037780156 8:21862554-21862576 TGTCCCTGGCAGTACTTCTATGG - Intergenic
1038530925 8:28317474-28317496 TCTCCTTTGTAGCGCTTGGATGG + Intronic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1041799560 8:61784461-61784483 TGTGCATGGAAGTACTTGGAGGG - Intergenic
1042279335 8:67039044-67039066 TGTTCTTGGCAGTACTTGCGTGG + Intronic
1042630301 8:70808648-70808670 TATCCTGTGCATGACTTGGAGGG + Intergenic
1043001536 8:74766019-74766041 TGTCCTTTGCAGGAACAGGATGG + Intronic
1043258803 8:78171063-78171085 TGTCCATTGTGTTACTTGGAAGG + Intergenic
1045961008 8:107968286-107968308 TGTCATTTCCAGTGCATGGATGG + Intronic
1046063992 8:109175237-109175259 TGACCTTTGGAGTCTTTGGAAGG - Intergenic
1046457651 8:114487996-114488018 TGACATTTGCAGCAATTGGATGG + Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1048179739 8:132184023-132184045 TGTCCTGTGCAGTCCTTATAAGG + Intronic
1048325616 8:133436817-133436839 TGTCCTTTGTTGGACTTTGAAGG - Intergenic
1049422289 8:142522348-142522370 TGTCCGGTGCAGTATTTGGGAGG + Intronic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1050846708 9:10230193-10230215 CCTCCCTTGCAGTCCTTGGAAGG + Intronic
1051272568 9:15369581-15369603 TATCCTTTGTAGTTCTTGGTTGG + Intergenic
1052129796 9:24829260-24829282 TGTCATTTGCAGCACTTTGGAGG + Intergenic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1056485337 9:87051301-87051323 TGTCTTTTGCAGAGCATGGATGG + Intergenic
1058234177 9:102468524-102468546 TGTCCTTTGAGGGACGTGGACGG + Intergenic
1058281074 9:103115498-103115520 TGGCCTTTGCAGGCATTGGAAGG - Intergenic
1058406463 9:104681056-104681078 TGTCATTTGCACAACATGGATGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1059595475 9:115715572-115715594 TTTCATGTGGAGTACTTGGATGG - Intergenic
1059831700 9:118103394-118103416 TGTCCTTTGCAGGGCATGGGTGG + Intergenic
1059841250 9:118219670-118219692 TGTCCTTTGCAGTAATCAGTGGG + Intergenic
1186051300 X:5598504-5598526 CGTCTTTTGCAGAACATGGATGG - Intergenic
1186418470 X:9404263-9404285 CGGCCTCTTCAGTACTTGGATGG + Intergenic
1187640241 X:21279763-21279785 TGTCTTTTGCAGGACATGAATGG - Intergenic
1187640561 X:21284263-21284285 TGTCCTTGGCAGGACGTGGATGG + Intergenic
1187724560 X:22189082-22189104 TGTCATTTGCAACACATGGATGG - Intronic
1189926742 X:45962709-45962731 TGTACTTTGCAGCACATGCATGG + Intergenic
1191026762 X:55922302-55922324 TGTCCTTTGTAGGACATGGATGG + Intergenic
1191991032 X:67037251-67037273 TGTCCTTTGTGGAACTTGGATGG + Intergenic
1192259294 X:69494722-69494744 TTTCCTCTGCACTCCTTGGAGGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1195207668 X:102619246-102619268 TGTCCTTTGCAGCAAATTGATGG - Intergenic
1195890281 X:109685899-109685921 TGCCCTTTGAAGTTCATGGATGG - Intronic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1196616478 X:117771688-117771710 TTTCATATGCATTACTTGGAAGG + Intergenic
1196643035 X:118085736-118085758 TGTCTTTTGCAGCAATTGGATGG - Intronic
1198283343 X:135165105-135165127 TGTGTTTTGGAGTATTTGGATGG - Intronic
1198285646 X:135188368-135188390 TGTGTTTTGGAGTATTTGGATGG - Intergenic
1198287616 X:135207379-135207401 CGTGTTTTGCAGTATTTGGACGG + Intergenic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1199747623 X:150783857-150783879 TGTTCTCTGCAGTGCATGGAGGG + Intronic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1202275668 Y:23117094-23117116 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202290360 Y:23303597-23303619 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202428660 Y:24750813-24750835 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202442131 Y:24919276-24919298 TGTCTTTTGCAGGAAGTGGATGG - Intergenic