ID: 930191879

View in Genome Browser
Species Human (GRCh38)
Location 2:48467955-48467977
Sequence CATGATGCACAGAAGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 238}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930191879_930191881 -10 Left 930191879 2:48467955-48467977 CCCTGCTTCTTCTGTGCATCATG 0: 1
1: 0
2: 1
3: 29
4: 238
Right 930191881 2:48467968-48467990 GTGCATCATGCAGTATTTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 145
930191879_930191884 16 Left 930191879 2:48467955-48467977 CCCTGCTTCTTCTGTGCATCATG 0: 1
1: 0
2: 1
3: 29
4: 238
Right 930191884 2:48467994-48468016 TGAACAGTGTTTATGTCTGTGGG 0: 1
1: 0
2: 3
3: 24
4: 316
930191879_930191882 -9 Left 930191879 2:48467955-48467977 CCCTGCTTCTTCTGTGCATCATG 0: 1
1: 0
2: 1
3: 29
4: 238
Right 930191882 2:48467969-48467991 TGCATCATGCAGTATTTTCAGGG 0: 1
1: 0
2: 5
3: 19
4: 220
930191879_930191883 15 Left 930191879 2:48467955-48467977 CCCTGCTTCTTCTGTGCATCATG 0: 1
1: 0
2: 1
3: 29
4: 238
Right 930191883 2:48467993-48468015 CTGAACAGTGTTTATGTCTGTGG 0: 1
1: 0
2: 5
3: 26
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930191879 Original CRISPR CATGATGCACAGAAGAAGCA GGG (reversed) Intronic
902889377 1:19430840-19430862 CCTGATGCACAGAAAAACCCTGG + Intronic
904277271 1:29392644-29392666 CATGAAGGGCAGAGGAAGCAAGG - Intergenic
906672147 1:47664202-47664224 CCTGATGCTGAGAAGAAGCAGGG + Intergenic
908934020 1:69352573-69352595 TATGTTGAACAGAAGAAGCCAGG + Intergenic
909570453 1:77104522-77104544 AATGAAGCACAGAAGAAAAAGGG + Intronic
912225544 1:107729547-107729569 CATGGTGCACTGAAGGGGCATGG + Intronic
912747620 1:112258497-112258519 CATGGTGCAGAGAGGAAGCAAGG - Intergenic
914768522 1:150661664-150661686 AATGAGGGACAGAAAAAGCATGG - Intronic
915152561 1:153846213-153846235 AAGGAAGCACAGAACAAGCAAGG - Intronic
915987679 1:160482547-160482569 CATAAGGCACAGAAGTAGGAAGG + Intergenic
916752166 1:167733216-167733238 CATGATGGACAGCAGAGTCAAGG - Intronic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
917765636 1:178213595-178213617 AATGATGAGCATAAGAAGCAAGG + Intronic
919364676 1:196642506-196642528 CATTATGCTCAGAAAAAGGATGG - Intergenic
919378609 1:196825627-196825649 TAACATGCACAGAAGAAGGATGG + Exonic
919390807 1:196983035-196983057 TAACATGCACAGAAGAAGGATGG + Exonic
924309971 1:242730929-242730951 CAATAGGCACAGAAAAAGCACGG - Intergenic
1063483174 10:6394743-6394765 CATGCTGCTCGCAAGAAGCAGGG + Intergenic
1064742312 10:18446197-18446219 CATGAAGCACAGAAGAATGGAGG + Intronic
1065100545 10:22326385-22326407 CATAATTCACAGAACAAGAATGG - Intronic
1065245164 10:23748806-23748828 CATGAAGAACAGAAGTAGGAAGG - Intronic
1066119309 10:32268496-32268518 CATGATACACAGAAAACTCAAGG + Intronic
1066143897 10:32536352-32536374 AATGATGCACAGGAGAGGCATGG - Intronic
1066180286 10:32955841-32955863 CATTCTGCACATGAGAAGCATGG - Intronic
1066482036 10:35806046-35806068 AATGTTGCAGAGAAGCAGCAGGG + Intergenic
1067700265 10:48566679-48566701 CATGACACAGTGAAGAAGCAGGG - Intronic
1069320894 10:67170336-67170358 CATGATTCACAGCAAAAACATGG + Intronic
1070521303 10:77255945-77255967 CCTGATGCAAAGAAGGAGCCTGG + Intronic
1071163533 10:82779092-82779114 TGTGATGCACAGTAGCAGCACGG + Intronic
1072379526 10:94853275-94853297 CATTATGCACAAAGGAAGGAAGG - Intergenic
1072391237 10:94989406-94989428 CATTATGCATAAAAGAAGGAAGG - Intergenic
1072639451 10:97200489-97200511 GATAAGGCACAGAAGGAGCACGG - Intronic
1078499640 11:11858173-11858195 CAAAATGTACAAAAGAAGCAAGG - Intronic
1078717361 11:13852950-13852972 TATGATGAATAGAAAAAGCAGGG + Intergenic
1078920299 11:15824160-15824182 CATGTTTCACAGAGGAAACATGG + Intergenic
1080690402 11:34552565-34552587 CATCCTGCACAGAAGCAGAAAGG + Intergenic
1080752400 11:35162839-35162861 GAGCATGCACATAAGAAGCAGGG - Intronic
1081200500 11:40209232-40209254 TATGATGGACAGTAGAAACACGG - Intronic
1083952346 11:65963864-65963886 GAAGGTGCACAGAAGAGGCAGGG + Intronic
1084132908 11:67151042-67151064 CATGGTGGATAGTAGAAGCAGGG + Intronic
1086231218 11:84572390-84572412 CAAGAAGGAGAGAAGAAGCAAGG - Intronic
1088371081 11:109089262-109089284 CATGATGCAAAGACGAATCATGG + Intergenic
1090527412 11:127552615-127552637 GATGATGCACATAAGAATGATGG - Intergenic
1090835201 11:130448972-130448994 TAGGATGCCCAGCAGAAGCATGG - Exonic
1091964419 12:4725933-4725955 AATCAAGCACAGGAGAAGCAAGG + Intronic
1092159643 12:6309267-6309289 CAGGATGCTCTGAAGAAGTAAGG + Intergenic
1092182304 12:6454082-6454104 TATGGGGCACAGAAGAAGAAAGG + Intronic
1094275031 12:28664747-28664769 CAGGATGAAGAGATGAAGCACGG + Intergenic
1094596987 12:31874734-31874756 CAGGAAGCACAGGAGATGCAGGG + Intergenic
1094771378 12:33664613-33664635 AATGTTGAACAAAAGAAGCAAGG - Intergenic
1095169105 12:39012439-39012461 CATGATACAGAGAATAAGCATGG - Intergenic
1095919271 12:47513251-47513273 CAGAAAGCAAAGAAGAAGCAAGG - Intergenic
1096258663 12:50077759-50077781 CAAGATGCAGAGCAGAAGCCAGG + Intronic
1096614324 12:52823157-52823179 AAGGATGCTCAGAAGAAGCTTGG - Exonic
1097179350 12:57162497-57162519 TATGATGCCCAGCAGCAGCAAGG + Exonic
1097486345 12:60207111-60207133 AATAATGCATAGAGGAAGCAAGG + Intergenic
1098140193 12:67443162-67443184 CAGAATGCAAAGGAGAAGCAAGG - Intergenic
1098877826 12:75884929-75884951 CATTATACACACAAGAAGAAAGG + Intergenic
1100932509 12:99626394-99626416 GATGATGCAAAGAACAAGGAGGG - Intronic
1101079178 12:101164571-101164593 CATGAAGGACTGAAGAATCAGGG - Intronic
1101226063 12:102689357-102689379 CATGAGGAACAAAAGAAACAAGG + Intergenic
1106762158 13:32877979-32878001 CAGGAGGCACAGAACAACCAAGG + Intergenic
1106809846 13:33349508-33349530 GAGCATGCACAGAAGCAGCAAGG + Intronic
1108725647 13:53177630-53177652 CATGATGAAAATAAAAAGCAAGG + Intergenic
1109850236 13:68053737-68053759 CATGATTCATAGAAGAAATAAGG + Intergenic
1110047170 13:70844922-70844944 CATGATGCAAAGCAGAGGCAGGG - Intergenic
1110555617 13:76856118-76856140 CAACATGCACAGACAAAGCAAGG + Intergenic
1113381226 13:109808032-109808054 CACGGTGCACAGAAGCAGCCTGG + Intergenic
1113445619 13:110364155-110364177 CATGCTGCACAGAAAGGGCAAGG + Intronic
1113598608 13:111552336-111552358 CAGGATGCAGACAATAAGCACGG - Intergenic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG + Intergenic
1119854022 14:77886047-77886069 AATGAGGCACAGAAAAAGCAAGG + Intronic
1120984464 14:90321868-90321890 CATGAAGAACAGAAAAGGCAGGG + Intronic
1121722812 14:96122765-96122787 CATGATTCACAGAAGGGGCTGGG + Intergenic
1122039107 14:98969853-98969875 CATGATGGACACAAGCAGGAGGG + Intergenic
1127218024 15:56845581-56845603 CACCAAGCACAGGAGAAGCAAGG - Intronic
1128609978 15:69065586-69065608 CATGAAGGAGAGAGGAAGCAAGG + Intergenic
1128636024 15:69302930-69302952 AATGAAGCAAAGAAGAAGCAGGG - Intronic
1129061982 15:72867489-72867511 CATGATCCATTGAAGAAGCAGGG - Intergenic
1129366972 15:75062202-75062224 CATGACTCACAGAAAGAGCAAGG - Intronic
1131773332 15:95765211-95765233 CAGAAGGCAAAGAAGAAGCAAGG + Intergenic
1135968483 16:27055048-27055070 CACGAAGCACAGAACAGGCAGGG - Intergenic
1137653142 16:50137430-50137452 CATGATGAACAGCAGAATCAAGG - Intergenic
1141417364 16:83886313-83886335 CATGATGAACAGAAACAGCCAGG + Intergenic
1141882891 16:86871658-86871680 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
1142292158 16:89198165-89198187 CATGGTGCCCAGCAGCAGCACGG + Exonic
1142341848 16:89528523-89528545 GATGATGTACAGAAGATGGAGGG + Intronic
1143790035 17:9287427-9287449 CAACAGGCACAGAAGAAGAAAGG + Intronic
1143995585 17:11003712-11003734 CAGGAAGAACAGGAGAAGCAAGG - Intergenic
1144349566 17:14382036-14382058 CATGAAGTAAAGAAAAAGCAGGG + Intergenic
1145001438 17:19307802-19307824 CGGGATCCACAGAAGAACCAGGG - Intronic
1146659792 17:34658104-34658126 CATGATGCACAGGATAAGAGGGG - Intergenic
1146933792 17:36797387-36797409 CACGAGGCACAGCAGAAGAATGG + Intergenic
1148957225 17:51363868-51363890 CCAGAAGCAAAGAAGAAGCAAGG - Intergenic
1149397589 17:56260734-56260756 CACCAGGCACAGTAGAAGCATGG + Intronic
1151737035 17:75949542-75949564 AGTGATTCACAGAAAAAGCAAGG - Exonic
1153805926 18:8707710-8707732 CATAACCCACTGAAGAAGCAGGG - Intronic
1155601713 18:27556323-27556345 CATGATTAACAGAAGAAAAATGG - Intergenic
1156389946 18:36640996-36641018 CATGTTGCAGAGAAGAAGGATGG - Intronic
1156435396 18:37122375-37122397 CATGAAGGGGAGAAGAAGCAGGG + Intronic
1157429788 18:47615266-47615288 CCTGAGGCACAGAGGGAGCAAGG + Intergenic
1157433409 18:47649672-47649694 CATGCTGCCCAGAAAAGGCAGGG - Intergenic
1158715303 18:59873782-59873804 CCAGATGCACAGAAGAAGCTTGG - Intergenic
1164212696 19:23114144-23114166 ATTTATGGACAGAAGAAGCAAGG - Intronic
1164905191 19:31961378-31961400 CATGGTGCACAGAAGAAGGGAGG - Intergenic
1165138094 19:33683490-33683512 CAGGAGGCAAGGAAGAAGCAAGG - Intronic
1165945547 19:39439697-39439719 GATGATCCACAGAAGCAACATGG - Intronic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
925885977 2:8394088-8394110 GCTGATCCACAGAAAAAGCAGGG + Intergenic
926528052 2:14007561-14007583 TATGACGCACAGCAAAAGCATGG - Intergenic
928801648 2:35101364-35101386 CATGATGCTGAGAGGAAGCCAGG - Intergenic
929138376 2:38646081-38646103 CAACAGGAACAGAAGAAGCAGGG - Intergenic
930191879 2:48467955-48467977 CATGATGCACAGAAGAAGCAGGG - Intronic
930631038 2:53755700-53755722 CATAATGCACACAAGATGCATGG + Intronic
931706104 2:64947764-64947786 CATTATGGACAAATGAAGCAGGG - Intergenic
931904411 2:66826807-66826829 GATAATGCACAGAAACAGCATGG + Intergenic
932387453 2:71349222-71349244 CATGAAGCACAACAGAAGAAGGG + Exonic
932972647 2:76564010-76564032 CATGGGGCACAGACGATGCAGGG + Intergenic
933716270 2:85363221-85363243 AATGATGAACAGCAGATGCATGG - Intronic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
936805770 2:116330625-116330647 CTTAATTCACAGAAGATGCAGGG + Intergenic
938039270 2:128062436-128062458 GGTGAAGCACAGAAGAGGCAGGG - Intergenic
939887946 2:147701684-147701706 CAGAAAGCAAAGAAGAAGCAAGG + Intergenic
941348615 2:164402976-164402998 CATCATGCAGAGCAAAAGCATGG + Intergenic
943930525 2:193845618-193845640 CATGATTCTAGGAAGAAGCATGG - Intergenic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
945586491 2:211670557-211670579 CATGAAGAAGAGAAAAAGCATGG + Intronic
946503987 2:220279466-220279488 CATGAATCAGAGAAGAATCATGG - Intergenic
947236685 2:227948789-227948811 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
1168838245 20:892014-892036 CTTGATGCAGAGTAGCAGCAGGG + Intronic
1169475841 20:5930470-5930492 CATGATCCACAGAGGAAGTCTGG - Intergenic
1170500120 20:16966890-16966912 TCTGAGGCCCAGAAGAAGCAAGG - Intergenic
1174033875 20:47653615-47653637 CATGATACACAGCAGAAGGAGGG - Exonic
1174707190 20:52669076-52669098 CATGATGCTCAGAAGCACAAAGG - Intergenic
1175720576 20:61284340-61284362 CGTGATGCACAAAAAAAGAAAGG - Intronic
1176276860 20:64277543-64277565 CCTGATGCCCAGCAGCAGCAGGG - Intronic
1176668695 21:9711915-9711937 GGTGATGCCCAGAAAAAGCATGG - Intergenic
1179227815 21:39471089-39471111 CAGAATGGACAGAAGAAGAAAGG - Intronic
1179334307 21:40435901-40435923 CATGATGCTGAGCAGCAGCAGGG + Intronic
1179429777 21:41312897-41312919 AATGGGGCAGAGAAGAAGCAAGG + Intronic
1183569107 22:38638987-38639009 CTTGATCCAGAGAAGCAGCAAGG + Intronic
1184414491 22:44344353-44344375 CAGGAAGCACAAAGGAAGCAGGG - Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
1185127640 22:49020484-49020506 AATGTTGCACAGCACAAGCACGG + Intergenic
950217236 3:11168381-11168403 GATGACGCACAGAGGAAGCGGGG + Intronic
950380121 3:12606064-12606086 CAAGTTCCACAGAAGCAGCAAGG + Intronic
950412057 3:12845081-12845103 CAAGATGCACAAACAAAGCAAGG + Intronic
951428523 3:22578038-22578060 CATCATGTTCGGAAGAAGCATGG - Intergenic
951760890 3:26146510-26146532 CATCATACACAGAAGATGGATGG + Intergenic
952005206 3:28835713-28835735 CATCATGCAAGGAAGGAGCAGGG + Intergenic
952890456 3:38036947-38036969 GGTGATGCACAGAAGAAATAGGG + Intergenic
952974034 3:38679047-38679069 CAGGATGCCCAGAAGGACCAAGG + Intergenic
953542524 3:43834747-43834769 CATGAGGTGCAGAAGAGGCAAGG - Intergenic
954758352 3:52855494-52855516 CAAGATGCACATAACAAGCTGGG + Intronic
956047755 3:65214546-65214568 GATGAGGCACAGAAGGAGAAAGG + Intergenic
956855947 3:73274878-73274900 CCTGAAGGACAGAAGAAGCCAGG - Intergenic
960690816 3:120344616-120344638 CATCATGAACAGAAAAAGGAAGG + Intronic
961302146 3:125929204-125929226 CATGAAGAACAGAAGAAGAGAGG + Intergenic
962075286 3:132075257-132075279 CATGAAGCACAGGCAAAGCAAGG + Intronic
962879016 3:139558810-139558832 CATGATGCACACATGGATCAGGG + Intergenic
964387686 3:156166134-156166156 CACGATACACAGCAGAAGTAAGG + Intronic
964424488 3:156536755-156536777 CATGAACCACAGAAGCTGCATGG + Exonic
965712366 3:171568282-171568304 CCAGAGACACAGAAGAAGCATGG + Intergenic
965902180 3:173655882-173655904 CAAAATGCACAGACAAAGCAAGG + Intronic
966007157 3:175029152-175029174 CATGATGAACAAAAGATGTATGG + Intronic
966347765 3:178997923-178997945 CAGGATGTGCAGCAGAAGCATGG - Intergenic
967100011 3:186208572-186208594 TTTGATGCACAGAACAGGCAGGG - Intronic
967363177 3:188655501-188655523 GAAGATGCATGGAAGAAGCATGG + Intronic
969758489 4:9166078-9166100 CATGAAGAACAGAAGAAGACAGG + Intergenic
971979516 4:33734607-33734629 CATAATGGACAGCAGAGGCAAGG - Intergenic
973312654 4:48726273-48726295 CATTATGCCCAGAAGGAGAAGGG - Intronic
974493487 4:62596557-62596579 CATCATGCAGATAATAAGCATGG + Intergenic
975489795 4:74976061-74976083 CCTGATCCACAGAAAAAGCATGG - Intronic
976070494 4:81234679-81234701 CACCATGCAAAGAAGAAGCAAGG - Intergenic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
979404584 4:120293876-120293898 CATAAGGCAAAGAAGAGGCAAGG + Intergenic
979808703 4:125008219-125008241 CATTATCCAGAGAAAAAGCAAGG + Intergenic
980080745 4:128341336-128341358 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
980338785 4:131513638-131513660 CAGAATGCAAAGGAGAAGCAAGG - Intergenic
982097971 4:151940611-151940633 CATGATGTACATAAGAACCAAGG - Intergenic
982775232 4:159434822-159434844 CCTGTTCCACAGGAGAAGCAGGG + Intergenic
984080361 4:175241202-175241224 CAGCATTCACAGAAGAAGCAGGG + Intergenic
985406087 4:189639610-189639632 GGTGATGCCCAGAAAAAGCATGG + Intergenic
986185046 5:5427797-5427819 AATGATGAACAGAAGAGGCATGG + Intronic
986368612 5:7059246-7059268 CATGAGGGACAGAAGTAGGAAGG + Intergenic
986514993 5:8551893-8551915 CATGATGCGCAGCAGCAACATGG - Intergenic
986988876 5:13528559-13528581 CATATTTCACAGAAGTAGCATGG - Intergenic
987289424 5:16494584-16494606 CAGAAGGCAAAGAAGAAGCAAGG - Intronic
988599185 5:32623754-32623776 CAAGATGCACAAACAAAGCAAGG - Intergenic
992068536 5:73129094-73129116 CAAAATGCACAAACGAAGCAAGG + Intronic
992159573 5:73987733-73987755 CATGATTCATAGCAGTAGCATGG - Intergenic
993843244 5:92907202-92907224 TATATTGCACAGAGGAAGCAAGG + Intergenic
996933353 5:128917928-128917950 ACAGATGCACAGAAGAAGCAAGG - Intronic
998329932 5:141316398-141316420 CCTGAAGCACAGAAGAATCAAGG + Intergenic
999598894 5:153238299-153238321 CATGTGTCACAGAAGAAGTATGG - Intergenic
999685968 5:154103495-154103517 CAAGACGCACAGCAGAAGGAAGG - Intronic
1000861446 5:166460822-166460844 CATGAGGCATAGAAGAGACAAGG - Intergenic
1001105223 5:168847670-168847692 CCTGATGCACAGGAGAAGGGAGG + Intronic
1001399551 5:171438402-171438424 CATGTTACACTTAAGAAGCATGG - Intronic
1002038981 5:176496741-176496763 CCTGATGCACAGAAGAAGTCAGG - Intronic
1007535284 6:42581669-42581691 CATTATGCTGAGAAGAAGCCAGG - Intronic
1013812406 6:114059688-114059710 CAGAAGGCAAAGAAGAAGCAAGG - Intronic
1014520080 6:122431980-122432002 CCTGTTCAACAGAAGAAGCAGGG - Exonic
1020319774 7:6931048-6931070 CATGAAGAACAGAAGAAGAGAGG - Intergenic
1020342467 7:7127038-7127060 CATGAAGTAGAGAAGAAGCAAGG + Intergenic
1020718580 7:11711765-11711787 CATGCTGCACAAGAGAAGTATGG + Intronic
1022535963 7:31098680-31098702 CATTATGCACAGATGCAGCGGGG + Intronic
1022543826 7:31166539-31166561 CATGCTGCACTGTAAAAGCAGGG - Intergenic
1023104742 7:36752563-36752585 CATGATACAGAGAAGAAAAAGGG + Intergenic
1023679470 7:42670416-42670438 TATTATATACAGAAGAAGCATGG + Intergenic
1024520373 7:50300577-50300599 CAGGATGCAGAGGAGAGGCAGGG - Intergenic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1026883240 7:73920596-73920618 CATGATGCACAGAACCCACAGGG + Intergenic
1028306045 7:89266146-89266168 CAAGCTGCTCAGAAGAAGAATGG - Intronic
1028937678 7:96484613-96484635 CATTATGAACAGAAAAGGCATGG + Intronic
1029035335 7:97513983-97514005 CAGAATGCACAGAAGGGGCATGG - Intergenic
1029056764 7:97753246-97753268 CAAGATACCAAGAAGAAGCATGG - Intergenic
1029352400 7:100023549-100023571 CAGGCTGCACAGGAGAAGGATGG + Exonic
1030758725 7:113323591-113323613 CAAAAAGCAAAGAAGAAGCATGG - Intergenic
1031431555 7:121676796-121676818 AATGATGCAGAGAAGGAGCAGGG - Intergenic
1032499605 7:132390673-132390695 CATGGGGCAGAGAAGAAGCGGGG - Intronic
1032673519 7:134107275-134107297 CAAGACGCACAGACAAAGCAAGG + Intergenic
1037802156 8:22041702-22041724 CATGCAGAACAGAAGAAGCATGG + Intergenic
1040389211 8:46935226-46935248 CATCTTTCAGAGAAGAAGCAGGG - Intergenic
1042411806 8:68474867-68474889 CTTGGTGCCCAGGAGAAGCAAGG + Intronic
1043107273 8:76130040-76130062 CCTGAAACACTGAAGAAGCACGG + Intergenic
1043163406 8:76873553-76873575 CAGCATGCAAAGGAGAAGCATGG + Intergenic
1043591945 8:81842829-81842851 CATGATGCAAAGTATGAGCACGG - Intronic
1044308758 8:90667470-90667492 CATGAGGCACATAAGCACCAAGG + Intronic
1044522668 8:93217510-93217532 CCTGAGGCACAAAAGGAGCAGGG - Intergenic
1044954758 8:97468407-97468429 TTTGAGGAACAGAAGAAGCAGGG - Intergenic
1046645156 8:116777797-116777819 CAGAATGGACACAAGAAGCAAGG - Intronic
1047721317 8:127642911-127642933 AATGAGGCATGGAAGAAGCAAGG + Intergenic
1049211442 8:141388275-141388297 CCTGATGCGAAGAGGAAGCAGGG - Intergenic
1049956408 9:696934-696956 ATTGATGCACAGATGAAGAAAGG + Intronic
1050034441 9:1420690-1420712 GATGATTTACAGAAGAAGCGAGG - Intergenic
1051255309 9:15207068-15207090 CAGGAGGCAAAGAGGAAGCAAGG - Intronic
1051734319 9:20182777-20182799 TATGATACAAAAAAGAAGCATGG + Intergenic
1053416403 9:37949584-37949606 CAGCATGGACAGAAGCAGCAAGG + Intronic
1053442047 9:38124716-38124738 CATGAAACACAGAAGAACCTTGG - Intergenic
1056435840 9:86575512-86575534 CAGAAAGCAAAGAAGAAGCAAGG + Intergenic
1060370938 9:123070346-123070368 CATCATACACAGAATAAGCCTGG - Exonic
1060406727 9:123376502-123376524 CATGAGGCAGAGCAGGAGCAGGG - Intronic
1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG + Exonic
1062639281 9:137509696-137509718 CATGATGCACAGCACAGGCATGG + Intronic
1203657172 Un_KI270753v1:9026-9048 GGTGATGCCCAGAAAAAGCATGG + Intergenic
1185705332 X:2262610-2262632 CATGGTGCCCTGAGGAAGCAAGG - Intronic
1185836935 X:3353384-3353406 CTAGCTGCACAGAACAAGCATGG - Intergenic
1190119918 X:47651009-47651031 CATGCTGCTCAGCGGAAGCAGGG + Intergenic
1190601711 X:52099525-52099547 CATGATGGACAGCAGAGTCAAGG - Intergenic
1192131554 X:68556796-68556818 CATGATTCTCAGAAGATACAGGG + Intergenic
1192364050 X:70455970-70455992 CTTGAGGCACTGAAGGAGCATGG - Intronic
1193050791 X:77097097-77097119 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
1193495669 X:82208506-82208528 CAAGTTTCACAGAGGAAGCAAGG - Intergenic
1193712592 X:84896277-84896299 AAAGATCCATAGAAGAAGCATGG + Intergenic
1193935980 X:87622349-87622371 CATGATGTGCAGAATAGGCAAGG + Exonic
1193996589 X:88372942-88372964 AATGATTCACAGAGGAAGTAAGG + Intergenic
1196360042 X:114842613-114842635 CAGAATGCTCAGAAGAAGCCTGG + Intronic
1197651762 X:129072917-129072939 CATGAGGCAAAATAGAAGCAGGG + Intergenic
1199388471 X:147250956-147250978 CCTGAACCACAGAATAAGCAGGG + Intergenic
1199391016 X:147279067-147279089 TATGACTCACAGAAGAACCATGG + Intergenic
1199671944 X:150155010-150155032 CAGGATGCACAGAAGGACCAGGG - Intergenic
1200078321 X:153562942-153562964 CATGGTGGACAGAGGGAGCAAGG + Intronic
1200735216 Y:6786815-6786837 CAAGATGCACAAAAAAAGCAAGG + Intergenic
1200745095 Y:6897214-6897236 CATGATGCACAGAAGAATGATGG + Intergenic
1200762638 Y:7054178-7054200 CAAGATGCACAAACAAAGCAAGG + Intronic
1200767902 Y:7096068-7096090 CTTGAAGCACAGGTGAAGCAGGG + Intergenic
1201400649 Y:13600552-13600574 CATGATGGACTGAGCAAGCATGG + Intergenic