ID: 930198359

View in Genome Browser
Species Human (GRCh38)
Location 2:48530313-48530335
Sequence CCCGGGACGCGGGCATCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 116}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930198347_930198359 10 Left 930198347 2:48530280-48530302 CCTCCCGCCGTGTCTGGGAAAGT 0: 1
1: 0
2: 0
3: 3
4: 73
Right 930198359 2:48530313-48530335 CCCGGGACGCGGGCATCTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 116
930198351_930198359 3 Left 930198351 2:48530287-48530309 CCGTGTCTGGGAAAGTTTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 77
Right 930198359 2:48530313-48530335 CCCGGGACGCGGGCATCTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 116
930198344_930198359 21 Left 930198344 2:48530269-48530291 CCAGGGTGGGGCCTCCCGCCGTG 0: 1
1: 0
2: 2
3: 10
4: 163
Right 930198359 2:48530313-48530335 CCCGGGACGCGGGCATCTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 116
930198349_930198359 6 Left 930198349 2:48530284-48530306 CCGCCGTGTCTGGGAAAGTTTGC 0: 1
1: 0
2: 0
3: 15
4: 185
Right 930198359 2:48530313-48530335 CCCGGGACGCGGGCATCTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 116
930198343_930198359 26 Left 930198343 2:48530264-48530286 CCTCTCCAGGGTGGGGCCTCCCG 0: 1
1: 0
2: 0
3: 37
4: 313
Right 930198359 2:48530313-48530335 CCCGGGACGCGGGCATCTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 116
930198341_930198359 28 Left 930198341 2:48530262-48530284 CCCCTCTCCAGGGTGGGGCCTCC 0: 1
1: 0
2: 5
3: 46
4: 336
Right 930198359 2:48530313-48530335 CCCGGGACGCGGGCATCTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 116
930198342_930198359 27 Left 930198342 2:48530263-48530285 CCCTCTCCAGGGTGGGGCCTCCC 0: 1
1: 0
2: 3
3: 38
4: 337
Right 930198359 2:48530313-48530335 CCCGGGACGCGGGCATCTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 116
930198339_930198359 30 Left 930198339 2:48530260-48530282 CCCCCCTCTCCAGGGTGGGGCCT 0: 1
1: 0
2: 3
3: 48
4: 404
Right 930198359 2:48530313-48530335 CCCGGGACGCGGGCATCTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 116
930198340_930198359 29 Left 930198340 2:48530261-48530283 CCCCCTCTCCAGGGTGGGGCCTC 0: 1
1: 0
2: 3
3: 41
4: 358
Right 930198359 2:48530313-48530335 CCCGGGACGCGGGCATCTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 116
930198348_930198359 7 Left 930198348 2:48530283-48530305 CCCGCCGTGTCTGGGAAAGTTTG 0: 1
1: 0
2: 0
3: 5
4: 89
Right 930198359 2:48530313-48530335 CCCGGGACGCGGGCATCTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930198359 Original CRISPR CCCGGGACGCGGGCATCTCC AGG Intronic
900299547 1:1969914-1969936 CCCGGGATGAGGGCAGCTTCGGG + Intronic
900569415 1:3351057-3351079 CCCAGGACACGGGGATCTCTTGG - Intronic
901318434 1:8324357-8324379 CTGGGGAAGAGGGCATCTCCCGG - Exonic
901635274 1:10667594-10667616 CCGGGGAAGCGGGCCTCACCTGG + Intronic
903541289 1:24097760-24097782 CCAGGGAAGCGGGAGTCTCCAGG + Intronic
912431455 1:109630442-109630464 CCCAGGACGCTGGGGTCTCCCGG + Intronic
913091408 1:115479080-115479102 CCTGGGACGCAGGCAGCTGCTGG - Intergenic
916259057 1:162822530-162822552 CCCGGGAGGCTGGCATCCCTGGG + Intergenic
916656028 1:166876066-166876088 CGGGCGACGCGGGCGTCTCCGGG + Intronic
920560546 1:206935544-206935566 GCCGGGACGCCGGCTTCTACTGG - Exonic
1063121621 10:3108895-3108917 GCCGGGCCGCGGGCATCTCTCGG - Intronic
1064107609 10:12513248-12513270 CCCTGGACGCGGGCAGCCCTGGG + Intronic
1068544136 10:58327257-58327279 CCCGGGACGCGGTCCTGGCCTGG + Intergenic
1073057124 10:100710049-100710071 CGCGGGGCGCGGGTTTCTCCCGG - Intergenic
1077010306 11:376568-376590 CCCGGGACGGGGGGACCCCCAGG + Exonic
1077327650 11:1970644-1970666 CCCAGGAGGCTGGCCTCTCCCGG - Intronic
1078131929 11:8620468-8620490 CCTGGAATGCGGGCATCTCCTGG - Exonic
1080034983 11:27700784-27700806 CGCGGGACGCGGGGTTCCCCGGG - Intronic
1080540403 11:33258378-33258400 CCCGGGACGCGGCCATCGGCTGG - Intronic
1081711516 11:45219566-45219588 CCAGGTACGTGGTCATCTCCCGG + Exonic
1083657140 11:64235003-64235025 CCTTGGACGCGGGCGTCTCGGGG + Intronic
1083676375 11:64327850-64327872 GCAGGGAAGTGGGCATCTCCTGG - Intergenic
1088686742 11:112290210-112290232 GCGGGGACGCGGGCGGCTCCGGG + Intergenic
1089102579 11:115975944-115975966 CATGGCACACGGGCATCTCCAGG - Intergenic
1202810632 11_KI270721v1_random:25824-25846 CCCAGGAGGCTGGCCTCTCCCGG - Intergenic
1094831423 12:34302003-34302025 CCAGGGACGCCAGGATCTCCAGG - Intergenic
1103919775 12:124393281-124393303 CCCAGGAACCGGGCAGCTCCGGG - Intronic
1104049691 12:125186949-125186971 CCCTGGCAGCGCGCATCTCCCGG + Intronic
1110879430 13:80553220-80553242 CCCTGGAAGCGGGCAGCTGCAGG + Intergenic
1113851532 13:113421134-113421156 CCCGGGACACGCACATCCCCAGG + Intergenic
1119601385 14:75979382-75979404 CCTGGGAGGTGGGCAGCTCCTGG - Intronic
1126849569 15:52789089-52789111 CCAGGGCCACGGGCAACTCCTGG - Exonic
1129199693 15:73991648-73991670 CCCGGGAACTAGGCATCTCCTGG - Intronic
1129790992 15:78340540-78340562 TCCGGGACCAGGGCACCTCCGGG - Intronic
1132480877 16:165599-165621 CCCGGGACTCTGGCAGCTACGGG + Intronic
1132572650 16:650761-650783 CCCTGGACTTGGGCCTCTCCAGG - Intronic
1139850937 16:69951387-69951409 CCCTGGCCGGGGGCATCTCCTGG + Exonic
1139879919 16:70174299-70174321 CCCTGGCCGGGGGCATCTCCTGG + Exonic
1140372595 16:74421228-74421250 CCCTGGCCGGGGGCATCTCCTGG - Exonic
1142546031 17:703479-703501 CCAGGGTCGAGGGCCTCTCCTGG + Intronic
1147617182 17:41836336-41836358 CCCGGATCGCGGCCATCTCCGGG - Intronic
1147741283 17:42672258-42672280 CCCGGAGCGCGGGCAAGTCCCGG + Exonic
1147934992 17:44006144-44006166 CCAGCGACGCGGTCACCTCCAGG - Exonic
1148215051 17:45829804-45829826 CAGGGGAAGCGGGCATCGCCAGG + Intronic
1148388645 17:47254251-47254273 CCCGCGACGCGCGCAGCCCCGGG - Intronic
1151807680 17:76416668-76416690 CCCGGGATGCTGGCATCACTGGG + Intronic
1152332991 17:79684510-79684532 CCCGGCACGTGAGCATCCCCAGG + Intergenic
1153320704 18:3771450-3771472 CCCGGGCCGAGCGCGTCTCCGGG - Intronic
1160540380 18:79617446-79617468 CCCGGGACGCCGCCCTCCCCGGG + Intergenic
1160543300 18:79637572-79637594 TTCGGGGCGCGGGCATCTCCCGG + Intergenic
1160862211 19:1242153-1242175 CCCGGGACGAGGGCAGCGCAGGG - Intronic
1161256450 19:3312665-3312687 ACCGGGACCCCGGCATCCCCTGG - Intergenic
1161302205 19:3548122-3548144 CCCGGAACACGGGCACGTCCTGG + Exonic
1161482549 19:4518164-4518186 CCCGGCTCTGGGGCATCTCCAGG + Intergenic
1161672932 19:5624091-5624113 CCCGGGAGGCGGGCAGAGCCTGG + Intronic
1162948498 19:14057446-14057468 CCCGGCCGGCGGGCAGCTCCGGG - Intronic
1163122865 19:15228297-15228319 CACAGGATGGGGGCATCTCCTGG + Intronic
1164733826 19:30525985-30526007 CCCAGGCCGCTGCCATCTCCTGG - Intronic
1164755031 19:30682784-30682806 CCCGGGGAGAGGGCACCTCCGGG - Intronic
1165654901 19:37524692-37524714 CCCGGGACCTGGGCGTCTCCTGG + Intronic
1166073306 19:40398837-40398859 CGCAGCACGTGGGCATCTCCCGG + Intronic
1167880176 19:52451202-52451224 CCTGGGACGCGCGCGTCTTCAGG + Intronic
1168590863 19:57633361-57633383 CCCGGGTCGCCCGCAGCTCCCGG + Exonic
925013386 2:503154-503176 CACGGGACGCGGGAATCACAGGG + Intergenic
926285340 2:11483066-11483088 CGCCGGACGCGGGCACTTCCTGG + Intergenic
929584039 2:43102212-43102234 CCTGGGACCTGGGCCTCTCCCGG - Intergenic
930198359 2:48530313-48530335 CCCGGGACGCGGGCATCTCCAGG + Intronic
933751108 2:85602540-85602562 CCCGGGACGCGAGAGTCCCCAGG + Intronic
934665129 2:96164348-96164370 CCCCTGACATGGGCATCTCCAGG - Intergenic
937221982 2:120346929-120346951 CCAGGGCCGCGCGCATCTGCCGG - Intronic
938448512 2:131395298-131395320 CTCGGGGCGTGGGCACCTCCAGG + Intergenic
947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG + Exonic
948066868 2:235087537-235087559 CCCGGGACCCAGCCATGTCCTGG + Intergenic
948570599 2:238914911-238914933 CCCGGAACCCGGGCATGGCCTGG - Intergenic
948879171 2:240847420-240847442 CCTGGCACACGGGCAGCTCCTGG - Intergenic
1169214783 20:3786636-3786658 GCCGGGCCGGGGGCACCTCCGGG + Exonic
1169231002 20:3889035-3889057 CCCGGGCCGCGGAACTCTCCTGG - Intronic
1170892539 20:20388372-20388394 TCCAGGGCGGGGGCATCTCCAGG + Intergenic
1174579682 20:51562760-51562782 GCCGGGAGGCGCGCAGCTCCCGG - Intronic
1176201003 20:63860572-63860594 CCAGGGAAGAGGGCAGCTCCAGG - Intergenic
1176289433 21:5036336-5036358 CCCGGGCCCAGGGCACCTCCCGG - Intronic
1178493955 21:33071356-33071378 CCCGCGAAGCGCGCAACTCCAGG - Exonic
1179183252 21:39062657-39062679 CCCGTGAAGCTGGCAGCTCCCGG - Intergenic
1179867797 21:44227251-44227273 CCCGGGCCCAGGGCACCTCCCGG + Intronic
1181567957 22:23751149-23751171 CCCGGCCCGCGGGCACTTCCGGG + Intergenic
1182903779 22:33920231-33920253 CCCGGGCCGGGAGCAGCTCCAGG - Exonic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1185183027 22:49373888-49373910 CTCAGGACCCGGGCATCTCATGG - Intergenic
1185318773 22:50190721-50190743 CCAGGGAGGCGGCCGTCTCCCGG + Intronic
1185420218 22:50730847-50730869 CCAGCGACGCGGGCTTCACCGGG - Intergenic
954433199 3:50482276-50482298 TCCAGGACGGTGGCATCTCCTGG + Intronic
955253377 3:57305980-57306002 CCCGGGCTGCGGGCATTTCTTGG - Intronic
955387626 3:58492117-58492139 CTCCGGCCGCGGGCATCTCCCGG + Intronic
962367397 3:134795563-134795585 CCTGGGACGCGGCGCTCTCCCGG + Exonic
963684343 3:148416649-148416671 CCCGGGCTGCGGGCATTTCTTGG - Intergenic
964571327 3:158110220-158110242 CCCTGGTCGTGGGCATCACCTGG - Exonic
968655895 4:1778324-1778346 CCCTGGCCACGGCCATCTCCGGG - Intergenic
969417060 4:7067851-7067873 CCCCGGAGCTGGGCATCTCCGGG - Intronic
971279932 4:25234366-25234388 CCGGGGACGTGGGGGTCTCCCGG + Exonic
985471732 5:50936-50958 GCCGGGCCCCGGGCATCCCCAGG - Intergenic
985535677 5:464642-464664 CGGGGCACGCGGGCCTCTCCGGG - Intronic
1004668894 6:17776950-17776972 CCCTGGACGCTGGCTGCTCCAGG - Intronic
1005627913 6:27680838-27680860 CCTGGGCCGTGGGCGTCTCCTGG + Intergenic
1005928937 6:30466445-30466467 CCAGGAACGCTGGCATATCCAGG - Intergenic
1008850201 6:56014228-56014250 CCCGGGCTGCGGGCATTCCCTGG + Intergenic
1012410178 6:98947816-98947838 CCCGCGGCGCGCGCCTCTCCCGG - Exonic
1019405457 7:881360-881382 CCCGGCACCCGTGCATCTGCGGG + Intronic
1019833739 7:3359655-3359677 CCCGGGAGCCCAGCATCTCCTGG - Intronic
1023382751 7:39624143-39624165 CCCAGGTCGCGGGCACCGCCCGG - Intronic
1030980997 7:116185597-116185619 CCAGGCACGCTGGCAGCTCCAGG + Intergenic
1032391569 7:131558107-131558129 CCCGGGACGCGGCTAGATCCTGG - Intronic
1035067241 7:156115712-156115734 GCCGGGTCGTGGGCATCTCTTGG - Intergenic
1036911544 8:12761390-12761412 CCAGGCACGCTGGCCTCTCCTGG + Intergenic
1048539848 8:135332848-135332870 CTCGGGTCGAGGGCCTCTCCTGG - Intergenic
1049338503 8:142099312-142099334 CTGGGGCCGCGTGCATCTCCTGG - Intergenic
1049531679 8:143158505-143158527 CCTGGGACGGGGGCTCCTCCTGG + Intronic
1053239917 9:36487353-36487375 TCCGGGCCACGGGCCTCTCCGGG - Intronic
1053367295 9:37532223-37532245 CCCAGGACACAGCCATCTCCAGG + Intronic
1053408974 9:37903701-37903723 CCCCGGGCGCAGGCAGCTCCCGG + Exonic
1053482316 9:38424567-38424589 CCCGGGCCGCGGGCACCGCGCGG - Intergenic
1056186570 9:84140677-84140699 GCCGGGACGCGGCCATCATCGGG - Intergenic
1056643435 9:88389053-88389075 CCGGGGACGCGGGCCTGCCCTGG + Intronic
1057268749 9:93635485-93635507 CCCCCGAGGAGGGCATCTCCAGG + Intronic
1060598366 9:124861729-124861751 CCCGGGCCGCGCGCCTCTCCCGG + Intronic
1061444040 9:130627511-130627533 GCAGGGACGAGGGCAGCTCCTGG - Intronic
1062250846 9:135592776-135592798 CCTGGGACGCTGGGACCTCCTGG + Intergenic
1062398043 9:136360448-136360470 CCCGGGAGGCAGGGATGTCCTGG + Intronic
1186798251 X:13067081-13067103 CCTGGGGCAGGGGCATCTCCCGG + Intergenic