ID: 930203397

View in Genome Browser
Species Human (GRCh38)
Location 2:48565346-48565368
Sequence CTGTATAAGAAGTCGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930203397_930203402 -1 Left 930203397 2:48565346-48565368 CCAGCCTCCGACTTCTTATACAG 0: 1
1: 0
2: 1
3: 9
4: 106
Right 930203402 2:48565368-48565390 GGTACTAATCCTATTCATGAGGG 0: 4
1: 94
2: 700
3: 1540
4: 2267
930203397_930203401 -2 Left 930203397 2:48565346-48565368 CCAGCCTCCGACTTCTTATACAG 0: 1
1: 0
2: 1
3: 9
4: 106
Right 930203401 2:48565367-48565389 AGGTACTAATCCTATTCATGAGG 0: 1
1: 27
2: 196
3: 1029
4: 2007

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930203397 Original CRISPR CTGTATAAGAAGTCGGAGGC TGG (reversed) Intronic
902448567 1:16483237-16483259 CTGAAGAATAAGTCGGCGGCTGG - Intergenic
902750467 1:18505633-18505655 CTGTAAAAGAAGTCTAAGGTAGG - Intergenic
906265857 1:44428851-44428873 CTGGATAAGAAGTTGGGGTCGGG + Intronic
908617629 1:65940174-65940196 TTGTATAAAAAGTAGGGGGCAGG + Intronic
910898331 1:92092102-92092124 CTGTATAAGAAGACTTAGGGCGG + Intronic
911606242 1:99908986-99909008 CTGTATAGGAAGTCCTGGGCAGG - Intronic
915151766 1:153838811-153838833 GTATATAAGAAGGCAGAGGCTGG + Intronic
921495642 1:215837764-215837786 CTAAATAAGAAATCTGAGGCTGG + Intronic
923784002 1:237050309-237050331 GTGTATAGGAACTCAGAGGCTGG + Intronic
1066018843 10:31276365-31276387 CAGGATAAGAAGGCGGAAGCAGG + Intergenic
1068413947 10:56692355-56692377 CTGTATAAGAAGCATGATGCTGG - Intergenic
1071105625 10:82090933-82090955 CTGTGTAACAAGGCTGAGGCAGG - Intronic
1079012136 11:16837534-16837556 ATGTATAAGAAATGGAAGGCGGG + Intronic
1083853625 11:65381423-65381445 CTTTATAAGAAATGAGAGGCTGG - Intronic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1086950882 11:92889158-92889180 CAGGAAAAGAAGTCGGAGGTAGG - Intronic
1088125394 11:106417883-106417905 CTTTATAAGATGCCAGAGGCTGG + Intergenic
1088217584 11:107529801-107529823 CTGTATTAAAAGTAGGAGACAGG - Intronic
1088898473 11:114095554-114095576 ATGTATAAGAAATTGGTGGCCGG - Intronic
1097285870 12:57876833-57876855 ATATATAAGAAATTGGAGGCTGG + Intergenic
1098701567 12:73634907-73634929 CTGTATAATATGTAGGTGGCAGG + Intergenic
1105838041 13:24227864-24227886 CTATATAAGAATTCTGAGGCCGG - Intronic
1107927895 13:45281177-45281199 CTGTATAAGGTGTGGGAGGTAGG + Intronic
1108002833 13:45920705-45920727 CTGGTTAAGAAGTCTGAGGTAGG + Intergenic
1111112771 13:83735768-83735790 CTGTATAGGAAGGCCGAGGTGGG - Intergenic
1119770198 14:77215823-77215845 CAGTAGAAGAAGTAGGAGGAGGG - Intronic
1121606849 14:95246855-95246877 CTCTATAAGAATTTGGGGGCAGG - Intronic
1124337085 15:28865619-28865641 CTGTATAAGAAGCATGGGGCTGG - Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1131243041 15:90764783-90764805 CTATATAAGATGTCCTAGGCCGG + Intronic
1133540637 16:6749530-6749552 CTGGATATGAAGTCAAAGGCAGG - Intronic
1135673169 16:24392029-24392051 GTGTATGAGATGTGGGAGGCAGG + Intergenic
1137381821 16:48006546-48006568 CTGTATAAGAAGCATGATGCTGG + Intergenic
1137527002 16:49245057-49245079 TTGTATAAGAAGTGTGATGCTGG - Intergenic
1139808347 16:69589288-69589310 CTAAAAAAGAAGTAGGAGGCTGG - Intronic
1142718199 17:1759065-1759087 CTTTTAAAGAAGTCGGGGGCCGG + Intergenic
1144361222 17:14495315-14495337 CTGTTTAAGAGATTGGAGGCTGG - Intergenic
1144653331 17:17020311-17020333 CTGGACAAGGAGTCGCAGGCTGG - Intergenic
1144942742 17:18952703-18952725 CTGGATCAGAATCCGGAGGCAGG + Intronic
1151121023 17:71793081-71793103 CTCTATAAGAAGGCGAAAGCGGG - Intergenic
1151867121 17:76811202-76811224 CTGTCTAAGAAGGGGGAGGTGGG + Intergenic
1152541472 17:80978872-80978894 CTGTAACAGAATTCGGAGACTGG - Intergenic
1156951209 18:42900600-42900622 CTGTATTAGAAGACAGAGTCAGG - Intronic
1157872840 18:51246383-51246405 CTTTATAAGAAGAGGAAGGCCGG + Intergenic
1158035741 18:53027738-53027760 CTGTAAAAGAAGTTGGAGGCTGG - Intronic
1158487864 18:57884107-57884129 CTTTATAAGAACTCCCAGGCCGG + Intergenic
1164713654 19:30376413-30376435 TGGTATAAGTAGTGGGAGGCAGG - Intronic
1165957750 19:39512333-39512355 CCATATAAGAAGCCAGAGGCTGG + Intergenic
925312549 2:2896130-2896152 CTGTACAAGAAGCCTGATGCTGG + Intergenic
928217456 2:29373826-29373848 CTGTAGAGGTAGTTGGAGGCAGG - Intronic
929014154 2:37477414-37477436 GTGTAGAAGAAATCTGAGGCTGG + Intergenic
930203397 2:48565346-48565368 CTGTATAAGAAGTCGGAGGCTGG - Intronic
933847323 2:86336842-86336864 CTGCAAAAGGAGTCGGAGCCGGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
944195593 2:197050029-197050051 CTGTACAAGAAGCATGAGGCTGG + Intronic
946338870 2:219056000-219056022 CTGCATAGGAAGTGGGGGGCAGG - Intronic
948302516 2:236918598-236918620 CTGTAGAAGAGGTCTGAAGCAGG - Intergenic
1168937442 20:1678208-1678230 CCTTATAAGAAGGAGGAGGCAGG - Intergenic
1172139707 20:32713817-32713839 GGGTATAAGAAGGGGGAGGCTGG + Intronic
1173590836 20:44223371-44223393 CTGTATAGGAAGTGGGGTGCTGG - Intergenic
1173826538 20:46051421-46051443 CTGTATGAGCAGTGGGAGGGTGG + Intronic
1177089410 21:16748245-16748267 CTGTATAAGAAGTATGATGCTGG - Intergenic
1180303969 22:11058262-11058284 GGGTCTAAGAGGTCGGAGGCTGG - Intergenic
1183868179 22:40720739-40720761 CCTTATAAGAAGTGGGAGGCCGG - Intergenic
949777224 3:7646722-7646744 ATGTATGAGAAGTTGGAGGATGG + Intronic
949898128 3:8785585-8785607 ATAGATAAGAAGTCAGAGGCTGG + Intronic
950162578 3:10771473-10771495 CTGGATAAGAAGACTGAAGCTGG - Intergenic
951050349 3:18086604-18086626 GTGCATAAGAGGTGGGAGGCAGG - Intronic
952258092 3:31712676-31712698 CTGCATAAGAAGTCAGACACAGG - Intronic
954613271 3:51957271-51957293 TGGTATTAGAAGTAGGAGGCTGG + Exonic
959849035 3:111066864-111066886 GTGTAAAAGAAGTGGGAGGCTGG + Intergenic
962102374 3:132356359-132356381 TTGGATAAGAAGTGGGAGGCAGG - Intronic
963299279 3:143580912-143580934 AGGTATAGGAAGTGGGAGGCAGG + Intronic
964165903 3:153704939-153704961 CTGTATAAGAAGTATGGGTCTGG + Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
970010574 4:11454576-11454598 GTGTATCAGAAGAAGGAGGCTGG + Intergenic
971287745 4:25306740-25306762 CTGTATGAGCAGGCTGAGGCTGG + Intergenic
972723483 4:41724266-41724288 CTGTATCAGGAGGCTGAGGCAGG + Intergenic
972910008 4:43803321-43803343 CTGTAGAACAAGTTGAAGGCAGG - Intergenic
973818708 4:54643250-54643272 CCGTATAGGAACTTGGAGGCAGG - Intergenic
974247851 4:59344609-59344631 CTGGATAAGAAGTAGCATGCTGG + Intergenic
976831230 4:89317016-89317038 CTGTATAAAAGCTCTGAGGCAGG + Intergenic
977153397 4:93542735-93542757 ATGAATAAGAAGGCAGAGGCTGG - Intronic
980154749 4:129091056-129091078 GTGTAGAAAAAGTCAGAGGCAGG + Intronic
980884234 4:138744650-138744672 CTGTGTATGAAGTCAAAGGCTGG - Intergenic
983863984 4:172741286-172741308 CTGCTTAAGAAGCCGGAAGCTGG + Intronic
984256111 4:177391952-177391974 CTGTATAGGAAGTTGGAGGGGGG + Intergenic
984931417 4:184850852-184850874 AAGTATAAGAAGGCAGAGGCTGG - Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
991902028 5:71470223-71470245 CAGTATAAGAAATCGTAGGCTGG - Intronic
994139459 5:96325774-96325796 CTTTCTAAGAGATCGGAGGCTGG - Intergenic
994367777 5:98934845-98934867 CTGTATAAGAATTAGGTGGAAGG + Intergenic
995609765 5:113897027-113897049 CTGAATAACAAGTGGGGGGCAGG + Intergenic
999817265 5:155189727-155189749 CTGTCAAAGAAGTAGGAGCCAGG + Intergenic
1001605111 5:172954271-172954293 CTGTAAAAGATTTGGGAGGCCGG + Intergenic
1010009888 6:71037576-71037598 CTGTATAAGAAGCATGATGCTGG + Intergenic
1014725198 6:124963680-124963702 CTGTATAAGAAATAAGAGGAGGG - Intronic
1020431362 7:8119547-8119569 CTTTAAAAGAAGCCAGAGGCCGG + Intronic
1020527573 7:9282088-9282110 CTGTATAGGAAGCAGGATGCTGG + Intergenic
1024598792 7:50961910-50961932 TAGTATAAGAGGTCAGAGGCTGG + Intergenic
1029798682 7:102923524-102923546 CTGTATAAGAATTTTAAGGCCGG + Intronic
1032624859 7:133580998-133581020 CTGTATAAGCAGTCTCATGCTGG + Intronic
1039351359 8:36767080-36767102 TTCTATAAGAATTCAGAGGCTGG - Intergenic
1042711266 8:71719975-71719997 GTGGACATGAAGTCGGAGGCGGG + Intergenic
1043108696 8:76150243-76150265 CAGTATTAGAAGGCTGAGGCAGG - Intergenic
1043271953 8:78345100-78345122 CTGTATATGAATTAGGAAGCAGG + Intergenic
1044047430 8:87454069-87454091 ATGTATAAGAAGTGGGTGGCAGG + Intronic
1045638802 8:104223830-104223852 CTGTTTAGAAAGTCGGTGGCTGG + Intronic
1046492863 8:114975792-114975814 CTGTACAAGAAGCATGAGGCTGG + Intergenic
1048383706 8:133891482-133891504 CTGTAAAAAAATTCTGAGGCTGG - Intergenic
1050874943 9:10622755-10622777 CTGTATAGGAAGCATGAGGCTGG + Intergenic
1057157686 9:92858027-92858049 GTGTATAATAAGTTGTAGGCAGG - Intronic
1189112534 X:38307264-38307286 CTGTGGAAAAAGTCTGAGGCTGG - Intronic
1192439437 X:71163928-71163950 CTGGATAACAGGTGGGAGGCAGG + Intronic