ID: 930205432

View in Genome Browser
Species Human (GRCh38)
Location 2:48583005-48583027
Sequence CAGTCTTATTTCAAAGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 319}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930205432_930205436 27 Left 930205432 2:48583005-48583027 CCCTGCTCTTTGAAATAAGACTG 0: 1
1: 0
2: 2
3: 22
4: 319
Right 930205436 2:48583055-48583077 GTTGACTGAATTCACCCATTTGG 0: 1
1: 0
2: 0
3: 12
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930205432 Original CRISPR CAGTCTTATTTCAAAGAGCA GGG (reversed) Intronic
900632566 1:3644454-3644476 CAGTCTCATTCACAAGAGCAAGG - Intronic
901073424 1:6535976-6535998 CAGTTATAATTAAAAGAGCATGG + Intronic
902607194 1:17575236-17575258 CAGGCTGTTTTCAAAGAGCATGG - Intronic
902842711 1:19085608-19085630 AAGTCCTATTTCAAAGCTCAGGG - Intronic
905420712 1:37841557-37841579 CAGTCTTTTTCCAGAGATCAGGG - Intronic
907605767 1:55815914-55815936 CAGCCAGATGTCAAAGAGCAGGG + Intergenic
908014917 1:59821390-59821412 CTGTCTTATTTCAGAGCTCATGG + Intronic
910032825 1:82751380-82751402 CTTTCATATTTCAAAGAGAATGG - Intergenic
911492636 1:98589046-98589068 CAGTCTGATATCAAACTGCAAGG + Intergenic
913275880 1:117137280-117137302 CAATCAGATTTCAAGGAGCAGGG - Intergenic
915026021 1:152830639-152830661 CAGTCTGAGTTCAAACTGCAAGG + Intergenic
915368416 1:155328354-155328376 CGGTCTTATTTTAAAGCCCAGGG - Intronic
916333642 1:163645625-163645647 CAGTCTGAGATCAAACAGCAAGG - Intergenic
917816753 1:178718539-178718561 CAGTGATAGTTCAAAGAGTAAGG + Intergenic
919040115 1:192376163-192376185 TAGTCTTATTTCAAGGAACATGG + Intergenic
919660884 1:200245190-200245212 AAGTTTTATTTCAAAGAAAAGGG - Intergenic
919783550 1:201239842-201239864 CAGTCTGAGATCAAAGTGCACGG - Intergenic
920750129 1:208666450-208666472 CAGTCTGTCTTCAAAGACCATGG - Intergenic
921019913 1:211226076-211226098 CTCTCGTATTTGAAAGAGCAGGG - Intergenic
921227496 1:213034928-213034950 CAGGCTAAGTTCAAAAAGCATGG + Intergenic
921267269 1:213431974-213431996 CAGTTTTATTTAAAATGGCAGGG + Intergenic
921528752 1:216253060-216253082 CAATACTTTTTCAAAGAGCAAGG + Intronic
921555609 1:216595084-216595106 CTGTCCTCTTTCATAGAGCAAGG - Intronic
922230107 1:223678279-223678301 CACTCCTATTTCCAAGAGAAAGG - Intergenic
922374388 1:224946222-224946244 CAGTCTGAGATCAAAGGGCAAGG - Intronic
923997821 1:239516508-239516530 TACTCTTATATCAAAGAGTATGG + Intronic
924099371 1:240587968-240587990 CAGTTTTCCATCAAAGAGCAAGG - Intronic
924242098 1:242051171-242051193 CAGTCTGAGTTCAAACTGCAAGG - Intergenic
924418141 1:243880809-243880831 AAGTGTTATATCAAAGAGAAAGG + Intergenic
924538629 1:244960159-244960181 CACTCATATTTTAAAGAGAAAGG + Intergenic
924888290 1:248244257-248244279 CAGTGTTATTCCCAATAGCAAGG + Intergenic
1065713404 10:28539316-28539338 AAGTCTTATTTTAACTAGCAAGG - Intronic
1066060481 10:31719407-31719429 CAGTCTGAGATCAAACAGCAAGG - Intergenic
1066582724 10:36898657-36898679 CAGTCTGAGATCAAACAGCAAGG - Intergenic
1066596356 10:37054521-37054543 CAGGCTTATCTCAAACACCAGGG - Intergenic
1066613092 10:37270116-37270138 CAATGTTATTTCAAACAGAAAGG - Intronic
1067458141 10:46438202-46438224 CAGTCTTATTCCCAACATCAAGG - Intergenic
1067629055 10:47946432-47946454 CAGTCTTATTCCCAACATCAAGG + Intergenic
1070705795 10:78637175-78637197 AAGTCTCATGACAAAGAGCATGG + Intergenic
1072363217 10:94681103-94681125 CAGTATTATTTCCAATAGCCAGG + Intergenic
1072371011 10:94766496-94766518 TAGTCCTATTGCAAAGAGTATGG + Intronic
1072388786 10:94960355-94960377 CAGTCTGAGATCAAACAGCAAGG - Intronic
1072431261 10:95373115-95373137 CAGATTTATTACAAAGAGCCTGG - Intronic
1073104009 10:101022011-101022033 CAGTCTTGTGTCCAAGAGAAGGG - Intronic
1075686130 10:124366603-124366625 CATTCCTAATTCAAGGAGCAGGG + Intergenic
1075761837 10:124863431-124863453 CAGGCTTCTTTCCAACAGCAGGG - Intergenic
1077067825 11:651631-651653 CAGTCTCCTTTCAAAGTGCTGGG - Intronic
1078918064 11:15799473-15799495 CAGTTATCTTTCAAAGAGCTGGG + Intergenic
1079371510 11:19857300-19857322 CAGACCTCTTTAAAAGAGCATGG + Intronic
1079888555 11:26020475-26020497 CAGTCTTATTTCATAGAGAATGG - Intergenic
1080209692 11:29771403-29771425 CAGTCTGAGATCAAAGTGCAAGG - Intergenic
1080820787 11:35804540-35804562 CAGTTTTATTTCAAATATGAGGG - Intronic
1081273446 11:41116926-41116948 CAGTCACATTGCAAAGGGCATGG - Intronic
1081422845 11:42892151-42892173 TAGTCTTATTAGAAACAGCAAGG + Intergenic
1082929367 11:58583756-58583778 CAGTCTTTTTTAAAAAAGTATGG + Intronic
1087333976 11:96819331-96819353 TGGTCATAATTCAAAGAGCAGGG - Intergenic
1087411142 11:97791397-97791419 CAGTTTTATTTCAAATATAAAGG - Intergenic
1087710568 11:101544976-101544998 CAATGTTATTTCACAGGGCAGGG - Intronic
1087746193 11:101950020-101950042 CAGCCATAAATCAAAGAGCAAGG + Intronic
1091608848 12:1985511-1985533 CAGTTTTACCTCACAGAGCATGG + Intronic
1093184541 12:16004714-16004736 CATTCTTTTTTCAAAAACCAAGG + Intronic
1093811811 12:23500940-23500962 CAGTATTATATAGAAGAGCATGG - Intergenic
1094076076 12:26475557-26475579 CATCCTTATTTCAATGAACATGG + Intronic
1094341087 12:29412040-29412062 CAGTCTGAGATCAAACAGCAAGG - Intergenic
1094616805 12:32043303-32043325 CAGGCTTATTTCAAACACCTGGG + Intergenic
1094877970 12:34672684-34672706 CAGTCTGAGATCAAACAGCAAGG - Intergenic
1095073829 12:37892800-37892822 CAGTCTGAGATCAAAGAGCAAGG + Intergenic
1095126492 12:38484606-38484628 CATGGTTATTTTAAAGAGCATGG - Intergenic
1095394084 12:41742826-41742848 CATTTTTATTTCAATGAGAAGGG + Intergenic
1096433821 12:51571381-51571403 CAGTCTGATATCAAACTGCAAGG - Intergenic
1097745771 12:63301571-63301593 CAGTATGTATTCAAAGAGCATGG - Intergenic
1101154911 12:101918245-101918267 CTGTCTCATTTCACATAGCAAGG + Intronic
1101495081 12:105246197-105246219 CAGTCTGAGTTCAAACTGCAAGG + Intronic
1101705253 12:107215277-107215299 TAGTCCTATTGCAAAGAGTAAGG - Intergenic
1104210320 12:126682872-126682894 CACTGTATTTTCAAAGAGCAGGG - Intergenic
1104406620 12:128523130-128523152 CTGTCTTATTTCACTTAGCACGG - Intronic
1104526057 12:129523782-129523804 AAGTCTGATTTCACAGAGAATGG + Intronic
1105298225 13:19109306-19109328 CAGTCTGAGATCAAACAGCAAGG - Intergenic
1106422890 13:29598045-29598067 CAGTCATATTTCAAACACCAAGG - Intergenic
1108012348 13:46030826-46030848 TAGTCTTCTGTCCAAGAGCATGG - Intronic
1109570250 13:64179212-64179234 CAGTCTTATTTTGAAGAGACAGG + Intergenic
1111156249 13:84330431-84330453 TAGGCTTATTTCAGAAAGCAAGG - Intergenic
1112079343 13:95951721-95951743 CAGTCTCATTTCACTGAACATGG + Intronic
1112108142 13:96264669-96264691 CAGTTTTATTTTACAGTGCAGGG + Intronic
1112530001 13:100191718-100191740 CAGTCATATTTCAAATGGCTGGG + Intronic
1113084909 13:106558996-106559018 CAGTCAGATTAAAAAGAGCAGGG - Intronic
1116492387 14:45520627-45520649 CAGTCATATTTCTATCAGCATGG - Intergenic
1116763373 14:49041522-49041544 TAGTCTCATTTCAGAGAGAAAGG + Intergenic
1118272653 14:64358161-64358183 GAATCTTATTTCAAAAGGCAAGG - Intergenic
1118968605 14:70612281-70612303 AGTTCTCATTTCAAAGAGCATGG + Intergenic
1121071757 14:91029619-91029641 CAGTCTTATTTTACAGATGAGGG - Intronic
1124953310 15:34343042-34343064 CAGTATTACCTCAACGAGCAGGG - Exonic
1125344142 15:38701990-38702012 CAGTCATATGGCAAAGGGCATGG - Intergenic
1125980315 15:43995380-43995402 AAGCCTGATTTCAAAGAGGATGG + Intronic
1127081239 15:55382092-55382114 GAGTCTTACTTCAAAGATGATGG + Intronic
1127189608 15:56515644-56515666 CAGTCTGAGATCAAACAGCAAGG - Intergenic
1127229842 15:56978520-56978542 CAGAATTGTTTCAAAAAGCAAGG + Intronic
1127939292 15:63677647-63677669 CACTAGTATTTCAAAGAACATGG + Intronic
1132483407 16:177489-177511 CAGACTTTATTCAAAGACCACGG - Exonic
1135301853 16:21335543-21335565 CAATCTTATTTACAATAGCATGG - Intergenic
1135851442 16:25967568-25967590 CAGTCTTATTTCTTAGAGGAAGG + Intronic
1136465863 16:30443198-30443220 CACTCTTATTTCACACAGCCAGG - Intergenic
1139110305 16:63882196-63882218 TAGTCTGACTTCAAAGAGCAAGG - Intergenic
1140767840 16:78176437-78176459 CAGTCTTCTTTTAAATGGCAGGG + Intronic
1144222538 17:13113079-13113101 CAGTCTTAAATAAAAGAGCTAGG + Intergenic
1146546476 17:33743077-33743099 CAGGATTATTTGCAAGAGCAGGG - Intronic
1149125269 17:53222336-53222358 CTGTAGTATTTGAAAGAGCATGG + Intergenic
1153044797 18:845992-846014 CATTATTAATTCAAAGAGTAAGG + Intergenic
1153210384 18:2756296-2756318 CAGGTTAATTTCAAAGATCAAGG - Intronic
1156434464 18:37111933-37111955 CAGTCTGAGTTCAAACTGCAAGG + Intronic
1156716865 18:40022640-40022662 CTGTGATATTTCAAAGAGCATGG - Intergenic
1156983674 18:43323542-43323564 AACTCTTATCTCATAGAGCATGG + Intergenic
1158054327 18:53260932-53260954 CAGTCTGATATCAAACTGCAAGG - Intronic
1158259361 18:55590080-55590102 CACTTTTGTGTCAAAGAGCAAGG - Intronic
1158502880 18:58019481-58019503 CAGTCTACTTTTAAAAAGCATGG + Intergenic
1159607081 18:70485807-70485829 CAGTGTTTATTCAAAGAGAAAGG + Intergenic
1159903252 18:74067439-74067461 CAGCCTTTCTTCAAAGAGCGTGG - Intergenic
1160276964 18:77445853-77445875 CAGTCTTCTTTCAATGTGAAGGG - Intergenic
1161245307 19:3248482-3248504 CTGGCTTATTTCACCGAGCATGG + Intronic
1162729106 19:12706921-12706943 CAGACTCATTTCACAGAGCCAGG + Intronic
1163957433 19:20657462-20657484 CAGTGTTATTGCAAAGGACATGG - Intronic
1165021598 19:32928850-32928872 CAGTCTCAGATCACAGAGCAGGG - Intronic
1166248600 19:41549435-41549457 CAGTCTTCTGTCAAAGAGGGAGG - Intergenic
1167403692 19:49290001-49290023 CACTTTTATTTCCAAGAGGAGGG - Exonic
1168200510 19:54811946-54811968 CTGTCTTATATCAAACAGCCAGG - Intronic
925722190 2:6840209-6840231 CAGTCCTACTGCAAAGAGCAAGG + Intergenic
926613154 2:14968086-14968108 CAGGCTTTTTGCAGAGAGCAGGG - Intergenic
927602242 2:24454190-24454212 CAGTCTCATTAGAATGAGCACGG + Intergenic
930205432 2:48583005-48583027 CAGTCTTATTTCAAAGAGCAGGG - Intronic
930229572 2:48829135-48829157 CTGTGTTATTTCAGAGAGCCAGG - Intergenic
930434131 2:51318454-51318476 CAGTCTGAGATCAAACAGCAAGG - Intergenic
930615310 2:53587418-53587440 CAGTCTGAGATCAAACAGCAAGG + Intronic
931118406 2:59189650-59189672 CATTCTAATTTCAAACTGCAGGG - Intergenic
931300686 2:60975108-60975130 GAGCCTTATTTCAAAATGCATGG + Intronic
931546850 2:63397839-63397861 CAGTATTATTTCAATGAGTTTGG + Intronic
932520213 2:72404121-72404143 CAGTCTGATATCAAACTGCAAGG + Intronic
932986760 2:76735666-76735688 ATTTCTTATTTCAAAGAGCAAGG - Intergenic
933029539 2:77310775-77310797 CAGTATTATTTAAAAAATCATGG - Intronic
934039156 2:88113642-88113664 CAGTGTCATTTCTAAGAACATGG + Intergenic
936748605 2:115612709-115612731 TAGTCTCATTTCACAGAGGAAGG - Intronic
937784836 2:125884504-125884526 AATTCTCATTACAAAGAGCAAGG - Intergenic
938887227 2:135663521-135663543 CATTCTTATCTAAAAGAGAAAGG + Intronic
939811444 2:146837856-146837878 AAGTCACATTGCAAAGAGCATGG - Intergenic
940809168 2:158223229-158223251 CAGTCTTAGATCAAACTGCAAGG + Intronic
942775786 2:179580831-179580853 CCGTCACATTGCAAAGAGCAGGG + Intronic
942989283 2:182179762-182179784 CAGTCTCTGTTCAAAGAGCTTGG + Intronic
943294393 2:186118196-186118218 CAGTCATATTCCGAAGAGCTGGG - Intergenic
944563148 2:200961616-200961638 CAAGCATACTTCAAAGAGCATGG + Intronic
944967412 2:204950917-204950939 CATTCTGATTTCAACTAGCAAGG + Intronic
946111876 2:217427014-217427036 CAGTGTTATTTCAAAGACTATGG + Intronic
946206155 2:218110332-218110354 CAGTCCTATCACAAAGAGTATGG + Intergenic
946606731 2:221413174-221413196 CAGTCTGATTACAAACAACATGG + Intergenic
946774246 2:223120974-223120996 CAGTCTTACTTCCAAGTGCCAGG - Intronic
947198818 2:227596458-227596480 CTGTCTTATTTCTAAGAGTGTGG + Intergenic
948700497 2:239756753-239756775 CAGTCTTATTTCAGAGACACTGG + Intergenic
948785841 2:240352363-240352385 CAGTGTTATTTCTGAAAGCAGGG - Intergenic
1169647550 20:7830172-7830194 GACTCTTATTTCAAATAGAAAGG + Intergenic
1171147998 20:22802639-22802661 CAGTCTCATTTCATGGAGCTGGG + Intergenic
1172953170 20:38735361-38735383 CTGTTTTGTTTAAAAGAGCATGG + Intergenic
1173265479 20:41475724-41475746 GGGTGTTTTTTCAAAGAGCATGG - Intronic
1174730067 20:52907419-52907441 CAGTCTTACATCAAAGCTCAGGG - Intergenic
1175639012 20:60611097-60611119 CAGCATTATTGCACAGAGCAGGG + Intergenic
1177764500 21:25441428-25441450 CTGTCTTATTTCAGAGAACCAGG - Intergenic
1182248114 22:28976698-28976720 CAGTTTTACTTCAAATTGCAAGG - Intronic
1182310640 22:29403113-29403135 CTGTCTTATTTCAAAAAGAAAGG - Intronic
1182690409 22:32157633-32157655 CCGTCTTATTTCAAAAAGAAAGG + Intronic
1182925210 22:34115971-34115993 CAGTCTCATTTTATAGAGGAAGG + Intergenic
1184486303 22:44781998-44782020 CAGTCCAATTTAAAAGAGAAGGG - Intronic
1184733823 22:46386273-46386295 CAATCATTTTTCTAAGAGCATGG + Intronic
1185259090 22:49851814-49851836 CAGTGTTACTTCCTAGAGCATGG + Intergenic
949266839 3:2167166-2167188 AAGTCTTCTTTTAAACAGCATGG - Intronic
949571613 3:5299437-5299459 CAGCCTTATTCCAAAAACCAAGG - Intergenic
950846389 3:16019891-16019913 CTATCTTAATCCAAAGAGCAAGG - Intergenic
951042702 3:18005417-18005439 CAGTCTGAGATCAAAGTGCAAGG - Intronic
951151232 3:19292591-19292613 TCCTCATATTTCAAAGAGCATGG + Intronic
951394231 3:22145431-22145453 CATTGGTAGTTCAAAGAGCAAGG - Intronic
951522699 3:23624338-23624360 CAGCCTAAAGTCAAAGAGCAGGG - Intergenic
951861990 3:27263546-27263568 CAGTCTGAGTTCAAACTGCAAGG - Intronic
952589756 3:34936871-34936893 CACTCATATTTAAAACAGCACGG + Intergenic
953462190 3:43090341-43090363 CATGCCTATTTGAAAGAGCATGG - Intronic
955268939 3:57477336-57477358 CAGTCTGATATCAAACTGCAAGG + Intronic
959471641 3:106759362-106759384 CAAGCTTATTTAAAAGAGCATGG - Intergenic
959551806 3:107668467-107668489 CAGTATTATTTCTATGAGCCCGG + Intronic
959770231 3:110086407-110086429 CAGTTTTATTTATAAGAGCCAGG + Intergenic
961062501 3:123843379-123843401 CATTCTTATCTCATAGAGGAAGG - Intronic
963708524 3:148718983-148719005 CAGTCTTGTTTCAAATGGAAGGG + Intronic
969005800 4:4019287-4019309 CAGTCTGAGATCAAACAGCAAGG - Intergenic
969945652 4:10781004-10781026 CAGTCTGAGATCAAAGTGCAAGG - Intergenic
969950301 4:10828916-10828938 CAGTCTGAGATCAAAGTGCAAGG - Intergenic
970143295 4:13006503-13006525 CAGACTTATTCCAAAGTTCACGG + Intergenic
970643243 4:18090631-18090653 CAGTCTGAGTTCAAACTGCAAGG + Intergenic
970729820 4:19089666-19089688 GAGTCTGATGTCCAAGAGCAGGG - Intergenic
972256854 4:37365315-37365337 CATTCATATTTTAAAGTGCAGGG + Intronic
973709842 4:53618409-53618431 CTTTGTTATCTCAAAGAGCAAGG - Intronic
973945398 4:55949416-55949438 CATTTTTGTTACAAAGAGCATGG - Intronic
974537569 4:63190436-63190458 TAGTCCTATTGCAAAGAGTATGG - Intergenic
974740397 4:65998896-65998918 CAGTCTGAGATCAAAGTGCAAGG - Intergenic
975034271 4:69661364-69661386 CAGTCTGACATCAAAGTGCAAGG - Intergenic
975092828 4:70423638-70423660 CAGTCTGAGATCAAACAGCAAGG - Intergenic
976467976 4:85393068-85393090 CATTTTTATTTCAAAGATAAAGG + Intergenic
976956864 4:90911891-90911913 CAGTCTGAGATCAAAGTGCAAGG + Intronic
978418418 4:108503520-108503542 CAGTCTGAGATCAAACAGCAAGG + Intergenic
979037541 4:115743500-115743522 CAGTCTTACTTCAGATTGCAAGG - Intergenic
980620283 4:135292374-135292396 CAGTATTAGTTCCATGAGCATGG + Intergenic
981263458 4:142751625-142751647 CAGCCTTATTGAATAGAGCATGG - Intronic
981345005 4:143664822-143664844 CAGTCTGAGATCAAACAGCAAGG - Intronic
982499249 4:156132287-156132309 CTGTCTTATTTCAGAGAACGAGG - Intergenic
982565141 4:156976524-156976546 CCTTCTTATTTCAAAGGTCATGG + Intergenic
984564882 4:181317616-181317638 TATTTTTATTTCAATGAGCAGGG + Intergenic
985083293 4:186288232-186288254 CAGTCTTCTGCCAATGAGCAGGG + Intronic
987603939 5:20108423-20108445 CAGTCTTATTTCGAGGAACTAGG + Intronic
988249803 5:28742053-28742075 AAGTTTTATTTCAAACAGTAAGG - Intergenic
988850363 5:35174522-35174544 CAGTGTTGTTTGAAAGAGAAAGG - Intronic
989138894 5:38182529-38182551 CAGACTTAGTAGAAAGAGCATGG + Intergenic
989656316 5:43748930-43748952 CAGTCTGAGATCAAACAGCAAGG - Intergenic
989816968 5:45748777-45748799 CAGTCTCATATCAAACTGCAAGG - Intergenic
989843627 5:46111939-46111961 CAGTCTGAGTTCGAACAGCAAGG - Intergenic
990215208 5:53523816-53523838 TAGTTTCATTTCAAATAGCACGG - Intergenic
990860388 5:60320211-60320233 CAGTCTGAGTTCAAACTGCAAGG - Intronic
991236513 5:64405697-64405719 CAGTCTTATTTCAGTGACCTTGG - Intergenic
992039045 5:72810348-72810370 CAGTTTTTTTTCTAAAAGCATGG - Intergenic
993569155 5:89514673-89514695 CAGTCTCTTTTCTAAGAACATGG + Intergenic
995203908 5:109457653-109457675 CAGTCTGAGATCAAACAGCAAGG + Intergenic
995287812 5:110411705-110411727 TAGTCTTATTTCACTGAGAATGG + Intronic
996477874 5:123941776-123941798 CAGTCTGATATCAAACTGCAAGG + Intergenic
996638634 5:125726309-125726331 CTGTCTTATTTTAGAGAGAAAGG + Intergenic
996680842 5:126226941-126226963 TAGTCCTATTGCAAAGAGTATGG - Intergenic
998112101 5:139510183-139510205 TAGTCCTATTGCAAAGAGTATGG - Intergenic
1000451230 5:161390346-161390368 CAGTACTATTCCAAAGTGCAAGG - Intronic
1000815816 5:165920192-165920214 CAGTCTTACTTCAGATTGCAAGG - Intergenic
1001009238 5:168083181-168083203 CAGTCTGATATCCAACAGCAAGG - Intronic
1001542785 5:172551072-172551094 CAGTCTCTTCTCAAAGAGCAAGG - Intergenic
1202775174 5_GL000208v1_random:63055-63077 CAGTCTGAGTTCAAACTGCAAGG - Intergenic
1202775395 5_GL000208v1_random:65673-65695 CAGTCTTAGATCAAACTGCAAGG + Intergenic
1004814132 6:19294139-19294161 CAGTATGCTTACAAAGAGCAAGG - Intergenic
1007668786 6:43534416-43534438 TTGTCTTAATTCCAAGAGCATGG + Intronic
1008864899 6:56198497-56198519 CAGTCTTACCTCAAAAAGCTGGG + Intronic
1009385339 6:63079934-63079956 TAGTCCTATTGCAAAGAGCATGG + Intergenic
1009564546 6:65295638-65295660 TAGTCTTATTTGCATGAGCAAGG + Intronic
1010691951 6:78921336-78921358 CAGTCTGAGATCAAACAGCAAGG + Intronic
1012442627 6:99275705-99275727 CAGTCTCATCTCAAAGATTAAGG + Exonic
1012445822 6:99306261-99306283 CAGTCTCATTTCATAGACCCCGG - Intronic
1013197709 6:107860329-107860351 CAGTCTGAGATCAAACAGCAAGG - Intergenic
1013702913 6:112795581-112795603 CAGTCTGATTTCTAAGATCTGGG + Intergenic
1015077659 6:129180855-129180877 AAGTCTTAGTTCTAAGATCAGGG + Intronic
1015476038 6:133659561-133659583 CATTCTAATTTTAAAAAGCAGGG - Intergenic
1015677949 6:135771094-135771116 CAGTCTGAGATCAAACAGCAAGG - Intergenic
1016400618 6:143676297-143676319 AATTCTTATTTCAAAGATCAAGG - Intronic
1016637477 6:146310549-146310571 AAGCCATATTTCAAAGAGCATGG - Intronic
1017101581 6:150853898-150853920 CAGTCCTATCGCAAAGAGTATGG - Intergenic
1022011768 7:26314060-26314082 CAGTCTCCTTTCAAAGTGCTGGG + Intronic
1022850819 7:34259974-34259996 CTGTCTTATTCTAAAAAGCAAGG - Intergenic
1024265731 7:47605055-47605077 CAGAATTCTTTCAAATAGCATGG + Intergenic
1024460029 7:49650136-49650158 CAGTCTGAGATCAAAGTGCAAGG + Intergenic
1024880992 7:54085014-54085036 CATATTTATTTCAAAAAGCATGG + Intergenic
1024901566 7:54323854-54323876 CAGTCTGATTTCAAACTGCAAGG - Intergenic
1025111398 7:56219403-56219425 CAGTCTTATTTCAAGTAAAATGG - Intergenic
1025582925 7:62742504-62742526 CAGTCTGAGATCAAACAGCAAGG - Intergenic
1027577327 7:79946817-79946839 CAGTCTGAGATCAAACAGCAAGG - Intergenic
1027792355 7:82650251-82650273 CAGTCTGAGTTCAAACTGCAAGG + Intergenic
1028065207 7:86375766-86375788 CAGTCTGAGATCAAACAGCAAGG + Intergenic
1028458264 7:91062129-91062151 CAGTCTGAAATCAAACAGCAAGG - Intronic
1028494619 7:91449491-91449513 TAGTCTTATCACAAAGAGTATGG + Intergenic
1029785011 7:102781073-102781095 CAGTCTGAGATCAAACAGCAAGG + Intronic
1029902278 7:104054148-104054170 AAGTCTTATATCAAAGCCCATGG - Intergenic
1031606817 7:123778504-123778526 CAGTATTATTTTTAAGAGCGTGG + Intergenic
1031936889 7:127744361-127744383 CTGTTTTATTTTAAAAAGCAGGG + Intronic
1033352596 7:140573745-140573767 CAGTCTTCTTTCACAGAGAAGGG + Intronic
1034302222 7:150026413-150026435 CTCTATTATTTCAAAGAGGATGG + Intergenic
1034803837 7:154070906-154070928 CTCTATTATTTCAAAGAGGATGG - Intronic
1035900706 8:3456040-3456062 CAGTCTCAGATCAAATAGCAAGG - Intronic
1036041318 8:5084860-5084882 CTGTCTTATTTCAAACCACATGG + Intergenic
1036543305 8:9740440-9740462 CAGTCTCATTACAAAGGGCCAGG - Intronic
1036975177 8:13403187-13403209 CAGTCTTGTTTCAAACAGCAGGG - Intronic
1037422302 8:18716058-18716080 GAGTGCTATTTCAAAGAGGATGG + Intronic
1037598097 8:20371223-20371245 GAGTCTGATTGGAAAGAGCAAGG - Intergenic
1038141154 8:24846755-24846777 CTGTCTTATTTAACAGAGCATGG + Intergenic
1039021788 8:33215901-33215923 GAATCCTATTTAAAAGAGCAGGG + Intergenic
1039170440 8:34739118-34739140 CAGTCTGAGATCAAAGTGCAAGG - Intergenic
1040066522 8:43149188-43149210 CCGATTTATTTAAAAGAGCATGG + Intronic
1040708159 8:50154132-50154154 CAGTCTGACATCAAAGTGCAAGG - Intronic
1040911459 8:52523062-52523084 CAGTCTCATTTTAAAGATAAAGG - Intergenic
1041002534 8:53466435-53466457 TAGTCCTATTGCAAAGAGTATGG - Intergenic
1041578178 8:59423720-59423742 CAGTCTTATTTCTAAATCCAGGG - Intergenic
1041638433 8:60170537-60170559 TAGTCTTTTTTCAAACAGTATGG + Intergenic
1042435204 8:68756150-68756172 CAGACATAATTTAAAGAGCAAGG - Intronic
1042467425 8:69143824-69143846 CAGTCTTATTTTAAAAATCTAGG + Intergenic
1043766613 8:84142129-84142151 AACTCTTATTGCAAAGAGGAAGG - Intergenic
1044930336 8:97246050-97246072 CAGTCTTGTCCTAAAGAGCAGGG - Intergenic
1045387755 8:101687885-101687907 AAGTCTGCATTCAAAGAGCACGG + Exonic
1046316414 8:112508738-112508760 CAGGATTATTGCAAGGAGCAGGG - Intronic
1046812596 8:118548934-118548956 CAGTCTGAGATCAAAGTGCAAGG + Intronic
1047046270 8:121056419-121056441 CAGTCTGAGATCAAACAGCAAGG - Intergenic
1047149516 8:122244814-122244836 CAGTCTGAGATCAAAGTGCAAGG + Intergenic
1047981890 8:130192056-130192078 CTTTCTTATTTCAAAGACAAAGG + Intronic
1051139118 9:13958990-13959012 TAGTCTTATTTGAAAAAGGAGGG - Intergenic
1051384924 9:16497412-16497434 CAGACATATGTCAAAGGGCATGG - Intronic
1051754628 9:20385277-20385299 TAGTATTATTTGAAAGAGAAGGG + Intronic
1051901800 9:22050973-22050995 CATTCTGATTTCAAACACCATGG - Intergenic
1052099152 9:24422470-24422492 CAGTATTATCTAAGAGAGCAAGG + Intergenic
1052105083 9:24504576-24504598 CAGTCTTATTGCAAAATACATGG - Intergenic
1052212792 9:25926955-25926977 GAGTAATGTTTCAAAGAGCATGG - Intergenic
1052734251 9:32323919-32323941 CAGTCTTCTTTTTAAGAGCCAGG + Intergenic
1055214155 9:73837589-73837611 CAGTATTATGTGAAAAAGCAAGG - Intergenic
1055548553 9:77408707-77408729 CAGTCTGAGATCAAAGTGCAAGG + Intronic
1056017639 9:82407571-82407593 CACTCTTACTTCAAAGGGCTGGG - Intergenic
1056332551 9:85533428-85533450 CAAACTTCTTTCAAAGAGAAAGG + Intergenic
1056582530 9:87902531-87902553 CAGTCTGATATCAAACTGCAAGG + Intergenic
1058807327 9:108604932-108604954 CATTTTTATGTCAGAGAGCAAGG - Intergenic
1059140349 9:111847284-111847306 TAGTCTTCATTTAAAGAGCAGGG - Intergenic
1060465784 9:123903754-123903776 CAGTCTGAGATCAAACAGCAAGG + Intronic
1060572605 9:124656453-124656475 CAGGCTTATTTCACTTAGCATGG - Intronic
1185685521 X:1925257-1925279 CATTCTTATTTTAAACAGCCGGG - Intergenic
1188448958 X:30288888-30288910 CAATCTTATCTAAAAGAGAAAGG + Intergenic
1189275141 X:39779944-39779966 CCGTCTTATTAATAAGAGCATGG - Intergenic
1189709099 X:43790939-43790961 CAGTCTTCTCTGAATGAGCATGG - Intronic
1189848709 X:45158387-45158409 CAGCCTTCTTTCCAAGGGCAGGG - Intronic
1189990427 X:46588682-46588704 AAGTCATATTTCAATGAGCTGGG - Intronic
1190127851 X:47722227-47722249 CAGCCCTCTTTCTAAGAGCATGG + Intergenic
1191076677 X:56460929-56460951 CAGTCTCAGATCAAACAGCAAGG - Intergenic
1191565011 X:62517497-62517519 CAGTCTGAGATCAAACAGCAAGG + Intergenic
1192598917 X:72440941-72440963 CAGTCTGAGTTCAAACTGCAAGG + Intronic
1192850768 X:74953649-74953671 CAGTCTGATATCAAACTGCAAGG + Intergenic
1192922289 X:75719638-75719660 CAGTCTGAGATCAAACAGCAAGG - Intergenic
1193017827 X:76755972-76755994 CAGTCTGAGATCAAAGTGCAAGG + Intergenic
1193038454 X:76979002-76979024 CAGTCTGAGGTCAAACAGCAAGG + Intergenic
1193197425 X:78649801-78649823 CAGTATTCTTTCTAAGAGCTAGG + Intergenic
1194252594 X:91595869-91595891 CAGTCTTAGCTCTAAGAACAAGG + Intergenic
1196175095 X:112631403-112631425 CAATCTTCTTTCAAAGCTCAAGG + Exonic
1197026744 X:121759899-121759921 TAGTATTCTTTCAAAAAGCATGG + Intergenic
1197432469 X:126383545-126383567 CAGTCTAAGTTCAAACTGCAAGG + Intergenic
1197438374 X:126460340-126460362 CAGTCTGAGATCAAACAGCAAGG + Intergenic
1198716717 X:139565579-139565601 CATTATTCTTTCAAAGTGCAGGG - Intergenic
1199503357 X:148534412-148534434 CAGACTTAGTTAATAGAGCAAGG + Intronic
1199655384 X:149989932-149989954 TAGTTTTATTTCAAAGAACAGGG - Intergenic
1200729859 Y:6722918-6722940 CTGTTTTATTTCATTGAGCAGGG - Intergenic
1200956211 Y:8948774-8948796 CAGTCTGAGATCAAACAGCAAGG - Intergenic
1201247093 Y:12015353-12015375 CAGTCTGAGATCAAACAGCAAGG - Intergenic
1201249277 Y:12039778-12039800 CAGTCTGAGATCAAACAGCAAGG + Intergenic
1201404330 Y:13634786-13634808 TAGTCCTATTGCAAAGAGTATGG - Intergenic
1201406995 Y:13659587-13659609 TAGTCCTTTTGCAAAGAGCATGG + Intergenic
1201531071 Y:14990172-14990194 TAGTCTTACTGCAAAGAGCATGG - Intergenic
1201602621 Y:15748058-15748080 CAGTCTGAGATCAAACAGCAAGG - Intergenic
1201988302 Y:19993598-19993620 CAGTCTGAGATCAAAGTGCAAGG - Intergenic