ID: 930207390

View in Genome Browser
Species Human (GRCh38)
Location 2:48601773-48601795
Sequence CCCTGGAAGGCTTTGTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 1, 2: 3, 3: 27, 4: 239}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930207380_930207390 27 Left 930207380 2:48601723-48601745 CCACCTAGGGTTTTGTGGGCCAT 0: 1
1: 0
2: 0
3: 14
4: 78
Right 930207390 2:48601773-48601795 CCCTGGAAGGCTTTGTGTAGAGG 0: 1
1: 1
2: 3
3: 27
4: 239
930207382_930207390 24 Left 930207382 2:48601726-48601748 CCTAGGGTTTTGTGGGCCATGGA 0: 1
1: 0
2: 1
3: 14
4: 154
Right 930207390 2:48601773-48601795 CCCTGGAAGGCTTTGTGTAGAGG 0: 1
1: 1
2: 3
3: 27
4: 239
930207383_930207390 8 Left 930207383 2:48601742-48601764 CCATGGATTTTACTCTGAGTGAG 0: 1
1: 2
2: 18
3: 43
4: 242
Right 930207390 2:48601773-48601795 CCCTGGAAGGCTTTGTGTAGAGG 0: 1
1: 1
2: 3
3: 27
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930207390 Original CRISPR CCCTGGAAGGCTTTGTGTAG AGG Intronic
901004897 1:6166841-6166863 CACTGGAAGGCTTCGAGCAGAGG - Intronic
901876523 1:12169878-12169900 CCCTGGAAGTCTTGGTGCTGAGG + Intronic
902554282 1:17237891-17237913 CTCTGCAAGGCTTACTGTAGAGG - Intronic
902870147 1:19309042-19309064 CCAGGGAAGGCTTTCTCTAGGGG + Intronic
903288459 1:22291843-22291865 CCATGGAAGGGTTTGAGAAGGGG + Intergenic
903742311 1:25565341-25565363 CCCTGGAAGCATTTGAGTGGAGG - Intronic
904119100 1:28184454-28184476 CCCTGGGGGGCTTTGAGCAGAGG - Intronic
904211239 1:28887804-28887826 CCCTGCCAGGCTTGGTCTAGGGG + Intronic
904730437 1:32586844-32586866 CATTGGAAGGTTTTGTGCAGAGG + Intronic
905473323 1:38208746-38208768 CACTGGAAGTGTATGTGTAGGGG + Intergenic
905922547 1:41729070-41729092 TCCTGGATGGCTGTGTGTTGGGG - Intronic
906179274 1:43804532-43804554 CTCAGGAAGTCTTTGTGGAGAGG + Intronic
907457769 1:54586368-54586390 CCCTGGAAGGATGTGAGCAGAGG - Intronic
907692544 1:56683898-56683920 CATTGGAAGGCTTTGATTAGTGG + Intronic
907754681 1:57300103-57300125 ACATGGAAGGCTCTGTGCAGGGG - Intronic
908247276 1:62237777-62237799 CCCTGGCAAGCATTCTGTAGGGG - Exonic
908508148 1:64826649-64826671 CACTGGGATGCTTTGAGTAGAGG + Intronic
910526964 1:88190454-88190476 CAATGGAAGGATTAGTGTAGGGG + Intergenic
911138593 1:94471090-94471112 CCCTTGAAGGGTGTTTGTAGGGG + Intronic
912883997 1:113449840-113449862 CCCTGGAACGTTTTGTTTGGGGG - Intronic
914226909 1:145728215-145728237 CCCTGGAAGGCTTTGTCTAGTGG + Intronic
914371327 1:147027181-147027203 GCTTGGCAGGGTTTGTGTAGAGG - Intergenic
915271748 1:154758581-154758603 CCCTGGCTGCCTTTGAGTAGTGG - Intronic
915762711 1:158331053-158331075 CCCTGGAAGGCTGTGAAGAGTGG + Exonic
915846018 1:159265941-159265963 CCCTGGAAGAGTTTGTGCACTGG + Intergenic
918118546 1:181517421-181517443 CCACGGAAGGCTTTGAGCAGGGG + Intronic
921532996 1:216307860-216307882 CCCAGGAAGGCTATGTGTTCAGG + Intronic
922036873 1:221857250-221857272 TCCTGGAAGGCTGCCTGTAGGGG - Intergenic
922755872 1:228096720-228096742 CCCTGGAAGGTTCTGTGTTGGGG + Intronic
923335779 1:232968924-232968946 CCCAGGAAGGCTTTCTATAGAGG + Intronic
923446117 1:234072867-234072889 CCCTGGAAGGCTTTGATTAGAGG + Intronic
1063614573 10:7590842-7590864 CCATGGAAGGCTTTGAAGAGAGG - Intronic
1063752906 10:8971967-8971989 ACCTGGAAGGTTTTATATAGTGG + Intergenic
1064494372 10:15892908-15892930 CCCAGTAATGCTTTGAGTAGAGG - Intergenic
1065095867 10:22280158-22280180 CACTGGAAGGGTTTGAGCAGAGG - Intergenic
1065630177 10:27671786-27671808 CCTTGGAAGGCGGTGTGTTGTGG - Intergenic
1067156938 10:43790159-43790181 CCCTGGAACGTTTTGTTTGGGGG + Intergenic
1070603128 10:77879419-77879441 CTCTGGAAGGTTCTGAGTAGAGG + Intronic
1071603836 10:86971482-86971504 CCCTGGAAGGTTTTGTCTAGTGG + Intronic
1071952035 10:90714439-90714461 TCCTGAATGGCTTTGTTTAGTGG - Intergenic
1072565740 10:96615301-96615323 CCCTGGAAGGCTTTGATCAAGGG + Intronic
1074391897 10:113065002-113065024 GACCAGAAGGCTTTGTGTAGAGG + Intronic
1074431750 10:113400684-113400706 CCATGGTAGGCTTTGGGGAGGGG - Intergenic
1075557791 10:123445823-123445845 CCCTGGAAGGCATTCTGGGGTGG - Intergenic
1075868997 10:125754332-125754354 ACATAGAAGGCTTTGTGGAGAGG - Intronic
1076734226 10:132451617-132451639 CCCTGGAATGCTGTGTTTTGGGG - Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077213922 11:1387336-1387358 TCCTGGAAGTGTCTGTGTAGCGG + Intergenic
1078006264 11:7534797-7534819 CTCTGGCAGGCATTGTGCAGTGG + Intronic
1078234823 11:9474849-9474871 CCCTGGAAGACTTAAAGTAGAGG + Intronic
1078562448 11:12384910-12384932 CTCGGGAAGACTTTGTGCAGAGG + Intronic
1079944753 11:26728023-26728045 CCCTGGAAGGTTTTGTTTTGGGG + Intergenic
1080535242 11:33215181-33215203 CCCTGGAAGGTTTTGAGTAGAGG + Intergenic
1082009324 11:47439645-47439667 ATCTGGAAGGCTTTGAGAAGTGG + Intronic
1083008447 11:59371142-59371164 ACCTGGAAGGCTATCTTTAGTGG - Intergenic
1083763958 11:64833353-64833375 CCCTGGGAGGCCTTGGGTAATGG - Intronic
1084183908 11:67460693-67460715 CACTGGAAGGCTGGGTGTGGTGG + Intergenic
1084592804 11:70100187-70100209 TCCTGCAGGGCTTTGTGCAGGGG - Intronic
1086087312 11:82968646-82968668 CCTTGGAGGGTTTTGAGTAGAGG - Intronic
1088467009 11:110151079-110151101 CCCTGTGAGTCTTTGTGGAGAGG + Intronic
1088737337 11:112738585-112738607 CCTTGGAGGGTTTTGAGTAGGGG - Intergenic
1089012191 11:115140365-115140387 TCCAGGGAGGCTTTGTGGAGTGG - Intergenic
1091394112 12:143134-143156 CCCTGGGAGGCTGCGTGTATGGG + Intronic
1092632929 12:10404342-10404364 ACCTAGAAGACTTTGTGTAAGGG - Intronic
1094484413 12:30913164-30913186 CCCTCTGAGGCTGTGTGTAGTGG - Intergenic
1094564946 12:31590870-31590892 CCCGGGAAGGCTTTCTGCGGAGG + Exonic
1096545716 12:52338795-52338817 CCTTGGAAGGTTTTGTGCACAGG - Intergenic
1098338016 12:69423410-69423432 TCCTGGAAGGCTTTCTGAGGAGG + Intergenic
1100535265 12:95503013-95503035 GTTTTGAAGGCTTTGTGTAGTGG + Intronic
1101157394 12:101940635-101940657 ACGTGGGAGGCTCTGTGTAGGGG - Intronic
1102544313 12:113643653-113643675 CACTGGAGGGTTTTATGTAGGGG - Intergenic
1103003005 12:117400408-117400430 GCTTGGAAGGCTTTGAGTAGGGG + Intronic
1103510790 12:121472338-121472360 CCCTGGAATGCTATGTTAAGTGG - Intronic
1106509266 13:30399027-30399049 CAAGAGAAGGCTTTGTGTAGAGG - Intergenic
1108174118 13:47774653-47774675 CCCTGGAATCCTTTTTATAGAGG + Intergenic
1108591019 13:51912978-51913000 CCTTGGAAAGCTTTGTTCAGTGG - Intergenic
1111089931 13:83431768-83431790 CCCTGGATGGCTTTAAGGAGAGG - Intergenic
1112275866 13:98018900-98018922 CCCTGGAAGGCTGGGGGCAGGGG - Intronic
1112577970 13:100653793-100653815 CCCTGGCAGGCTTTGAGTTATGG - Intronic
1114413098 14:22518746-22518768 CTCAGGAGGGCTTTGTGTCGGGG + Intergenic
1117402509 14:55371032-55371054 CCCTGGAAGGCAGTGGGTGGGGG - Intronic
1117475026 14:56085461-56085483 CCTTGGAAGGTTTTGAGCAGAGG - Intergenic
1118865012 14:69695952-69695974 GCCTGGGAGGCTTTCTTTAGGGG + Intronic
1120712277 14:87805335-87805357 TCCTGGTAGTCTTTGTCTAGGGG - Intergenic
1121912340 14:97802886-97802908 CCCTGGAGGGTTTTAGGTAGAGG + Intergenic
1122585484 14:102803198-102803220 TCCTGGCAGGCTTTTTATAGAGG + Intronic
1122664482 14:103319186-103319208 CCCTGGAAGGCTGTGAGGAGGGG - Intergenic
1123540452 15:21284576-21284598 GCCTGGAGGGCTTTGTGGTGTGG + Intergenic
1127197842 15:56609187-56609209 CCCAGGAGGGCAATGTGTAGTGG - Intergenic
1127565335 15:60182657-60182679 CCTTGGAAGGTTTTTTCTAGTGG - Intergenic
1128034138 15:64508404-64508426 CCATTGAAGCCTTTGTGAAGTGG + Intronic
1128290759 15:66476705-66476727 CCATGGCAGGCTCTGTGCAGGGG + Intronic
1129831819 15:78675719-78675741 CCATGGAGGGCTTTGTGTCCAGG + Intronic
1130077287 15:80700137-80700159 CCCTGGAAGGATGTGTGTTGAGG - Intronic
1130078488 15:80710390-80710412 CATTGGAGGGCTTTGGGTAGAGG + Intronic
1130609353 15:85346898-85346920 ACCAGGAAGGCATTGTGTAGAGG - Intergenic
1131284169 15:91043759-91043781 CCATGGAGGGCTTTGTGTCCAGG - Intergenic
1131465190 15:92649147-92649169 CCCATGTAGGCTTTGTGTATGGG - Intronic
1132117474 15:99147973-99147995 CCTAGGAAGGCTGTGTGTATTGG + Intronic
1132394505 15:101462961-101462983 CCTGGGAAGGCTTTGTGCAGAGG + Intronic
1132394685 15:101464130-101464152 CCTGGGAAGGCTTTGTGCAGAGG - Intronic
1202948766 15_KI270727v1_random:11718-11740 GCCTGGAGGGCTTTGTGGTGTGG + Intergenic
1133303569 16:4797107-4797129 CCCTGGAGGGCATGGTGTCGGGG - Exonic
1133466308 16:6030360-6030382 TCCTGGCAGGCTTTGTGAAAAGG - Intronic
1135473844 16:22756104-22756126 CAGTGGAAGACTTTCTGTAGGGG + Intergenic
1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG + Intergenic
1136056672 16:27694959-27694981 CTGTGGAAGGCTGTGGGTAGAGG - Intronic
1136625846 16:31461817-31461839 GCCTGGAAGGCTTTCAGAAGAGG - Intronic
1137290490 16:47049125-47049147 CCCTGGAAGCCTTGGTGGAGAGG - Intergenic
1138280917 16:55771680-55771702 CCCTGCAGGGTTTTGTGCAGAGG - Intergenic
1138287610 16:55822186-55822208 CCCTGCAGGGTTTTGTGCAGAGG + Intronic
1139158105 16:64468802-64468824 GCCTGGAAGCCATTATGTAGAGG + Intergenic
1139200841 16:64975318-64975340 TCATGGAAGGCTTTGAGCAGAGG + Intronic
1139672655 16:68502264-68502286 CCCTGGAAGTGTTTGTGAAGGGG - Intergenic
1141475030 16:84267243-84267265 CCCAGGCAGTCTTTGTCTAGAGG + Intergenic
1142890773 17:2941034-2941056 CCCTGGCAGGGTGTGGGTAGTGG + Intronic
1143107668 17:4537632-4537654 CCCTGGAAGGATGTGTGTGTTGG + Exonic
1143401978 17:6651964-6651986 CCGTGGACGTCTCTGTGTAGCGG - Exonic
1148128647 17:45249348-45249370 TCCTGGAAGGCTGAGGGTAGAGG + Intergenic
1148479444 17:47950454-47950476 CCCTAGAAAGTTCTGTGTAGTGG + Intergenic
1149598973 17:57881110-57881132 CCCTGGGAGGCTGTGTGTGCTGG - Intronic
1149881194 17:60292812-60292834 CACTGGAAGGTTTTGAGTAGAGG - Intronic
1150196811 17:63307186-63307208 CACTGGAGGGTTTTGCGTAGGGG + Intronic
1150612052 17:66741234-66741256 CCCTGGAAGGCAAAGTATAGTGG - Intronic
1151561175 17:74870605-74870627 CCCTGAAGGGCTTTGTATAAGGG - Intronic
1152421896 17:80198136-80198158 CCCTGGAAGGCTTGATGTCTCGG + Exonic
1152811298 17:82384041-82384063 CCCTGGAAGGCCCTGGGCAGTGG + Intergenic
1157427000 18:47592650-47592672 CCCAGGAAGGCTTTCGGCAGAGG + Intergenic
1158817911 18:61125205-61125227 CACTGGAAGATTTTGTTTAGGGG - Intergenic
1160944289 19:1634013-1634035 CCCTGGAAGGCCTGGTGTGGTGG + Intronic
1161210664 19:3063554-3063576 CCCTGGAAGGCTGTGGGAGGAGG + Intergenic
1161480112 19:4506160-4506182 CCCTGGAGGGCTCTGGGCAGAGG - Intronic
1161620955 19:5296816-5296838 CCATGGAGGGCTGTGGGTAGAGG + Intronic
1161642913 19:5435584-5435606 CCATGGAGGGCTGTGGGTAGAGG - Intergenic
1161747181 19:6068146-6068168 CCATGGGAGGCTTTGCTTAGGGG + Intronic
1162785370 19:13031596-13031618 ACCTGGCAGGCTTTGGGTAAAGG + Intronic
1163429896 19:17261079-17261101 CCCTGGAGGGTTTTGAGCAGAGG - Intronic
1165311577 19:35031848-35031870 CTCAGGAAAGCTTTGAGTAGTGG + Intronic
1165775940 19:38404319-38404341 CTCTGGAAGGCTTTAGGTGGGGG + Intronic
1166854537 19:45777029-45777051 TCCTGGAGGGCTTTCTGGAGTGG - Intronic
1167739100 19:51312994-51313016 CCCTGGAACTCTTTGTTCAGGGG - Intronic
1168700940 19:58439332-58439354 CCATGGAAGGTTTGGAGTAGAGG - Intronic
926219594 2:10925844-10925866 CCATGGAAGGCTTTAGGCAGAGG - Intergenic
927554632 2:24023235-24023257 CCCTGGTAGGCTGGGTGTGGGGG + Exonic
927588878 2:24335619-24335641 CCCTGGAAGGCTGGGTGCAGTGG - Intronic
927622367 2:24675503-24675525 TCCCATAAGGCTTTGTGTAGTGG + Intronic
929432923 2:41903549-41903571 CACTGGAAGGCTTTGGTGAGAGG - Intergenic
930207390 2:48601773-48601795 CCCTGGAAGGCTTTGTGTAGAGG + Intronic
930701290 2:54459399-54459421 TCCTGGAAGGGTTTGTAGAGTGG + Intronic
930744561 2:54868765-54868787 CCCTGGAAGGGTCTGTGTCCCGG + Intronic
932285670 2:70529732-70529754 CCCTGGAAGACTTTGAGCAGAGG + Intronic
938840186 2:135153668-135153690 CCCTGGAAGATTTTGTGAGGTGG + Exonic
939595389 2:144116535-144116557 TCCTTGAAGGCATTGTGTACGGG - Intronic
939826975 2:147026677-147026699 CCTGTGAAGGCTTTGAGTAGGGG + Intergenic
941348376 2:164399691-164399713 CCCTGGAAGGGTTTATGTTATGG + Intergenic
941397655 2:164993082-164993104 GCCTGGAGGGCTTTGTGATGTGG + Intergenic
941649165 2:168074688-168074710 CCGTGGAGGGTTTTGTGTACGGG + Intronic
942560749 2:177215761-177215783 CCCTGGAACGTTTTGTTTGGGGG - Exonic
942872582 2:180753183-180753205 CCCTACAAGCCTTGGTGTAGTGG - Intergenic
943711812 2:191105295-191105317 CATTGGAAGGTTTTGGGTAGAGG - Intronic
944086312 2:195851548-195851570 CCCTTGAAGCATTTGTGTGGTGG + Intronic
944599542 2:201289597-201289619 CCCTGGATGGCTCTGGGTTGGGG - Intronic
946537798 2:220650321-220650343 CCCTGGAAGGAGTTATGTTGTGG - Intergenic
948162606 2:235837270-235837292 CCCTTGAAGGCTGGGTGCAGTGG - Intronic
948843956 2:240674406-240674428 TCCTGGAAGGATCTGTGCAGAGG + Intergenic
948849855 2:240700229-240700251 TCCTGGAAGGATCTGTGCAGAGG - Intergenic
1169199214 20:3699515-3699537 CCCTGGAAGGCTTTCTATATAGG - Intronic
1169965538 20:11213520-11213542 ACCTGGAGGGCTTTGTGTTGGGG - Intergenic
1172032096 20:31989420-31989442 CCTTGGAAGGCTTTGAGAAGGGG + Intronic
1172880374 20:38195807-38195829 CCCTGGCAGTCGTTGGGTAGTGG + Intergenic
1174363232 20:50041236-50041258 CCCTGGAGGGCTCTGAGCAGAGG - Intergenic
1174674925 20:52344576-52344598 CCATGGGAGGCTTTGAGAAGAGG + Intergenic
1175138736 20:56843893-56843915 GCCTGGAAGGCTAATTGTAGGGG + Intergenic
1176292563 21:5053968-5053990 CCCAGAAAGGCATTGTGTGGGGG + Intergenic
1180928391 22:19572114-19572136 CGCAGGCATGCTTTGTGTAGAGG + Intergenic
1182423466 22:30259761-30259783 CCCTGGAAGGCGATGGGGAGAGG + Intergenic
1183292147 22:37009524-37009546 AGCTGGAAGGTTTTGTTTAGAGG - Intergenic
1183537896 22:38413689-38413711 CCCTGGCAGCCTTTGGGGAGGGG - Intergenic
1184649179 22:45911824-45911846 CCCTGGGAGGCTCTCTGGAGCGG + Intergenic
1185161349 22:49231782-49231804 CCCTGTAAGGATCTGTGTGGTGG - Intergenic
949323880 3:2842318-2842340 CCCTGGAAGATTTTGTGTTTGGG - Intronic
950127848 3:10521223-10521245 CCCTGTGAGGATTTGTGTGGGGG - Intronic
950616849 3:14166634-14166656 CTGGGGAAGGCTTTATGTAGGGG - Intronic
951867970 3:27328667-27328689 CACTGGAAGGCTCTGGGGAGAGG + Intronic
953026267 3:39146969-39146991 CCTGGGAAGGCTTTGGGCAGAGG - Intronic
953351491 3:42219654-42219676 CCCTGCAAGGCTTAATGTTGAGG + Intronic
953655067 3:44844790-44844812 CCCTGGAATGCTTGGTGTTTGGG - Intronic
954570566 3:51637482-51637504 TTCTGGAGGGCTTTGTGCAGAGG + Exonic
956445183 3:69319099-69319121 CCCTTGATAGGTTTGTGTAGAGG - Intronic
957028655 3:75214756-75214778 CCCTGGAACGTTTTGTTTGGGGG - Intergenic
959854173 3:111128917-111128939 CCATGGAAGGTTTTGAGGAGAGG - Intronic
961250978 3:125505255-125505277 CTCTGGAAGGCTGGGTGCAGTGG - Intronic
961558576 3:127713373-127713395 CGCAGGAAGGCTCTGTGTAACGG + Intronic
966155693 3:176913913-176913935 TCATGGAAGGCTTTGTGGGGAGG - Intergenic
969375529 4:6761025-6761047 CCATGGAAGGCTTTGAGCAGAGG - Intergenic
971087525 4:23296229-23296251 CACTGAAAGGTTTTGTGCAGAGG + Intergenic
971255360 4:25009114-25009136 CCATGGAGGGTTTTGTGCAGAGG - Intronic
972349852 4:38226428-38226450 CACTGGAAGGTTTTGAGCAGGGG - Intergenic
978495570 4:109356313-109356335 ACCTGGAAGGCTTTGTGCATTGG + Intergenic
979302459 4:119102371-119102393 CCCTGTAAGGTTCTGTGAAGGGG + Intergenic
981054124 4:140342301-140342323 CCCTGAAAGGCTTAGAGAAGGGG - Intronic
982290459 4:153776486-153776508 CCCAGGAAGACTGTGTTTAGGGG + Intergenic
982311173 4:153986628-153986650 CTCAGGAAAGCTTTGGGTAGGGG + Intergenic
984284539 4:177712405-177712427 CCCTAGATATCTTTGTGTAGTGG + Intergenic
985928969 5:3040951-3040973 CCTTGGAAGGGTTTGTATTGAGG + Intergenic
986446315 5:7824563-7824585 CCCGGGAGTGCTTTGTGTACTGG - Intronic
987164989 5:15188343-15188365 CCCTGGAAAGTAATGTGTAGAGG - Intergenic
987312800 5:16697133-16697155 CCCTAGAAGGTTTGGTTTAGGGG - Intronic
989352194 5:40499320-40499342 CCTTTGAAGGGTTTGTGTTGTGG - Intergenic
991005776 5:61826666-61826688 CCCTGGTTGGCCTTGGGTAGTGG - Intergenic
993890969 5:93472822-93472844 CACTGGAATGCTTTGTTTAAAGG - Intergenic
995848475 5:116519979-116520001 CACTGGAAGGCTTTATGGAAGGG - Intronic
998765369 5:145480713-145480735 CTCAGGGAGGCTTTGAGTAGAGG - Intronic
1000097498 5:157984749-157984771 GCCAGGAGGGCTTTGTGCAGCGG - Intergenic
1000473984 5:161681992-161682014 CCCTGGCAGCCATTGTGTAGAGG - Intronic
1000614141 5:163409296-163409318 CCCTGCAAGGCTATCTTTAGTGG + Intergenic
1001721518 5:173860738-173860760 CCCCGGAAGGCTCTGGGCAGAGG - Intergenic
1001779673 5:174357209-174357231 CCCTGAAAGACTCTGTGGAGAGG - Intergenic
1001939262 5:175729210-175729232 CACTGGAAGGTTTTGAGCAGGGG - Intergenic
1002094329 5:176822267-176822289 CCCTGGAAGTATTTGTGTGGAGG + Intronic
1007913604 6:45539975-45539997 CCCAGGAAATCCTTGTGTAGTGG + Intronic
1007950546 6:45868484-45868506 CCATGGAATGCCTTGTGGAGAGG - Intergenic
1008166877 6:48149793-48149815 CCCTGGAACGTTTTGTTTGGGGG + Intergenic
1010328613 6:74594566-74594588 TCCTGGAAGGCTGCCTGTAGGGG - Intergenic
1010463882 6:76143879-76143901 CCCAAGAAGGCTTTGTCTTGAGG - Intergenic
1012512739 6:100023036-100023058 CCCTGGGAGGCTGAGTGAAGAGG + Intergenic
1013614790 6:111832212-111832234 CCCTGGAAGCACTTGTGTAATGG - Intronic
1017552693 6:155526141-155526163 CCCTGGAAAGTTTTGAGTAGAGG + Intergenic
1017876042 6:158524959-158524981 CCGTGGAAGGCTCTGGGCAGAGG - Intergenic
1019779232 7:2929843-2929865 CCCTGGATGGCATTCTGCAGGGG + Intronic
1020768476 7:12356204-12356226 CCATGGCAGCCTTTGTGAAGTGG - Exonic
1020921514 7:14270814-14270836 CCTTCGAAAGCTTTCTGTAGGGG + Intronic
1022477861 7:30723525-30723547 CCATGGAAGGCTTTATGGTGGGG + Intronic
1022983683 7:35628627-35628649 CCCTGGAGGCCATAGTGTAGGGG - Intergenic
1026486356 7:70825185-70825207 CTCTGGAAGGTTTTGAGCAGAGG - Intergenic
1026514495 7:71056722-71056744 CCCTGGAAGGCCTTGTGGATGGG - Intergenic
1028873306 7:95792775-95792797 CCTAGGAAGGCTTTCTGGAGGGG + Intronic
1029382900 7:100225084-100225106 CCCAGGAAGGCTCTGGGTGGAGG + Intronic
1029701783 7:102251709-102251731 CCCTTGAGGGTTTTGTGGAGAGG - Exonic
1032776102 7:135114825-135114847 CACTGGAAGGCATTGAGCAGAGG - Intronic
1032838431 7:135695278-135695300 CCCTGGATGGCTCTGTGCAAGGG - Intronic
1034541107 7:151758858-151758880 TCCAGTAAGGCTTTCTGTAGCGG + Intronic
1034817155 7:154182425-154182447 CTCTGGAAGGTTTTATGTCGGGG + Intronic
1040499022 8:47991292-47991314 CCCTGGAAGCCTTTTTTGAGTGG - Intergenic
1040854380 8:51933405-51933427 CCCTGGAGAGCTATGGGTAGGGG + Intergenic
1041435836 8:57840782-57840804 CCCCTGAATGCTTTGTTTAGGGG + Intergenic
1041802593 8:61815856-61815878 CCCTGGCTGGTTTTGTTTAGAGG + Intergenic
1044634573 8:94309755-94309777 CTCTGGAAGGCTATGGGGAGAGG + Intergenic
1045521206 8:102904768-102904790 CACTGGAAGGCTTTTTGTTTGGG - Intronic
1047692439 8:127370136-127370158 TACTGGAAGGCTTTGTATATAGG + Intergenic
1048491909 8:134901939-134901961 CCCTGGGAGGCTGGGTGTTGTGG - Intergenic
1048621021 8:136133138-136133160 CCCTGGAAGGCTTTCTTTTGGGG + Intergenic
1049446710 8:142634650-142634672 CTCTGGAAGGCTGGGTGCAGTGG - Intergenic
1057089719 9:92246447-92246469 CCCTGAAATGCTCTGTATAGGGG + Intronic
1057791078 9:98125509-98125531 CCCTGGAAGTCAGTCTGTAGTGG - Intronic
1058775567 9:108280007-108280029 CCTTGGAAGGCTTTGGACAGAGG + Intergenic
1060930421 9:127486311-127486333 CCCTGGAAGGATAAGTGAAGGGG + Intronic
1062007924 9:134250748-134250770 CCCTGAAGGGCTATGAGTAGGGG + Intergenic
1062429054 9:136518909-136518931 CCCAGGAAGGCTTCCTGGAGGGG - Intronic
1186939159 X:14485843-14485865 CACTGGAATGCTTTCAGTAGAGG - Intergenic
1187685724 X:21813885-21813907 CCCTGTTAGGCTTTGTCTGGAGG - Intergenic
1192233066 X:69278941-69278963 CCCTTGAAGGCTTGGAATAGGGG - Intergenic
1194673790 X:96768931-96768953 CCCTGGAAGGGTTTGAGCCGTGG + Intronic
1195753545 X:108179584-108179606 TCCTGCAAGGCCTTGTGCAGAGG + Intronic
1198761012 X:140032551-140032573 CCCTGGAACGTTTTGTTTGGCGG - Intergenic
1199260441 X:145767336-145767358 CCCTGGAAAGCTGTCTGTTGTGG + Intergenic
1202380485 Y:24273033-24273055 ACCAGGAAGGCATTGTGTAGAGG - Intergenic
1202490299 Y:25397092-25397114 ACCAGGAAGGCATTGTGTAGAGG + Intergenic