ID: 930213635

View in Genome Browser
Species Human (GRCh38)
Location 2:48670220-48670242
Sequence TTTGTTTTATTAGTAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421750
Summary {0: 1, 1: 51, 2: 6010, 3: 188511, 4: 227177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930213635_930213638 -7 Left 930213635 2:48670220-48670242 CCTGTCTTTACTAATAAAACAAA 0: 1
1: 51
2: 6010
3: 188511
4: 227177
Right 930213638 2:48670236-48670258 AAACAAAAATTAGCAGGGCATGG 0: 15
1: 1452
2: 42103
3: 108833
4: 170197
930213635_930213640 24 Left 930213635 2:48670220-48670242 CCTGTCTTTACTAATAAAACAAA 0: 1
1: 51
2: 6010
3: 188511
4: 227177
Right 930213640 2:48670267-48670289 GCCTGTAAACCCAGCTACTCAGG 0: 324
1: 75119
2: 208972
3: 229818
4: 173901
930213635_930213639 -4 Left 930213635 2:48670220-48670242 CCTGTCTTTACTAATAAAACAAA 0: 1
1: 51
2: 6010
3: 188511
4: 227177
Right 930213639 2:48670239-48670261 CAAAAATTAGCAGGGCATGGTGG 0: 857
1: 34861
2: 109636
3: 190270
4: 202449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930213635 Original CRISPR TTTGTTTTATTAGTAAAGAC AGG (reversed) Intronic
Too many off-targets to display for this crispr