ID: 930213871

View in Genome Browser
Species Human (GRCh38)
Location 2:48672703-48672725
Sequence CTGTGATTATGTAGTCAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930213871 Original CRISPR CTGTGATTATGTAGTCAAAT GGG Intronic
902631076 1:17705078-17705100 CTCTGAACATGTAGTCCAATAGG + Intergenic
909516740 1:76517732-76517754 CTGTGAATATATACTAAAATAGG - Intronic
924863602 1:247953541-247953563 CTGTGGTTCAATAGTCAAATAGG + Intronic
1064155093 10:12897215-12897237 GTGTGATTAAGAAGTCAACTGGG - Exonic
1064511103 10:16092562-16092584 TTGTGATAATGAAGCCAAATAGG + Intergenic
1065622847 10:27600846-27600868 CTGAGATTACCTAGTAAAATGGG + Intergenic
1066264186 10:33759422-33759444 CTGTGAATATGTGGAAAAATAGG - Intergenic
1068248072 10:54399122-54399144 ATGTGATTATGTATTCAAAATGG - Intronic
1074503846 10:114049768-114049790 CTGTTATAATGTAATCAAAGAGG + Intergenic
1077447598 11:2605681-2605703 CTGTTACTTTGTAGTCAATTTGG + Intronic
1078321423 11:10338490-10338512 CTGTGATTATTAATTCAACTGGG + Intronic
1078645223 11:13135906-13135928 CTGTGTTTATGCAGGGAAATGGG - Intergenic
1079694857 11:23468583-23468605 CTCTGATAAAATAGTCAAATTGG - Intergenic
1080953877 11:37069524-37069546 CTGTAAGTATGTAGTGAAATGGG - Intergenic
1084917626 11:72441035-72441057 CTTTGATCATGTAGTTAAATTGG - Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1086752356 11:90512797-90512819 CTGGGACTATGTAATCAAAAGGG + Intergenic
1086797718 11:91128970-91128992 ATTTGATTCTGTAGTTAAATTGG - Intergenic
1090624933 11:128598503-128598525 CTGTGATTCTGGTGTAAAATAGG + Intergenic
1092635841 12:10447845-10447867 CTGTGTTTATTCAGTCAATTGGG - Intronic
1106134864 13:26966458-26966480 GTGTGATTGTTAAGTCAAATTGG + Intergenic
1106291539 13:28367660-28367682 CTGCATTTATGTAATCAAATAGG - Intronic
1109667878 13:65563051-65563073 TTGTGATTATTTAATCAAAGGGG + Intergenic
1111034827 13:82658788-82658810 CTGTGACTACATATTCAAATTGG - Intergenic
1111256352 13:85674468-85674490 CTTTAATTATGTAATAAAATTGG - Intergenic
1111721729 13:91955202-91955224 GTGTGTTTATGTATTTAAATTGG + Intronic
1111990819 13:95115349-95115371 CTTTGATCCTGTACTCAAATTGG + Intronic
1112963491 13:105158326-105158348 CTGTGGTTAAGGTGTCAAATGGG - Intergenic
1113139846 13:107135015-107135037 CTGTCATAATATAGTCCAATGGG - Intergenic
1115606629 14:35009547-35009569 TTGTGAAAATGTAGTGAAATAGG + Intronic
1124988076 15:34642501-34642523 CTGAGATCATGAAGTCAAACAGG + Intergenic
1126204595 15:46030889-46030911 CTGTGCTTTTGCAGTCAAATAGG + Intergenic
1126535800 15:49762569-49762591 TTGTGAATATGTGGACAAATTGG - Intergenic
1126835445 15:52659377-52659399 TTGTGATTATATAGTCATATTGG - Intronic
1127025261 15:54797941-54797963 CAGTGAGTTTATAGTCAAATAGG - Intergenic
1131701318 15:94939204-94939226 CTGTGTTTTTGTAATTAAATGGG + Intergenic
1131947050 15:97635014-97635036 CTGTGATTTTGTAGAAAAATTGG - Intergenic
1132211772 15:100029166-100029188 TTGTGATTATGGAGTCAGAATGG + Intronic
1133595840 16:7290986-7291008 CTGTGATTATTTATTTAACTAGG + Intronic
1136925510 16:34369472-34369494 CTGTGATTTTGAAATCAATTTGG - Intergenic
1136979064 16:35042334-35042356 CTGTGATTTTGAAATCAATTTGG + Intergenic
1137580079 16:49628212-49628234 GTGTGAGTATGTAGATAAATGGG - Intronic
1143042898 17:4052511-4052533 CTGTGATTCTGGAGTGAAAAAGG - Intronic
1143900591 17:10171618-10171640 CTGTGATTATTTAGGGAGATGGG - Intronic
1144282223 17:13737397-13737419 CTGTGCTTATGTAATCAGAATGG - Intergenic
1145726658 17:27133560-27133582 ATGTGATGATGTATTCAAAATGG - Intergenic
1148385601 17:47232467-47232489 CTGTGGTTATGTTGGCAAAGAGG + Intergenic
1149111334 17:53034343-53034365 CTATCACTCTGTAGTCAAATAGG - Intergenic
1150712447 17:67543449-67543471 CAGTGATTATGTGGAGAAATTGG - Intronic
1150933476 17:69610657-69610679 CTGTGAGTAGGTAGTGATATAGG + Intergenic
1153835060 18:8956194-8956216 CTCTGACCTTGTAGTCAAATGGG + Intergenic
1156335156 18:36164876-36164898 TTGTGATTATGTAGTCAAGATGG + Intronic
1157643171 18:49238838-49238860 CTGTGAATACATAATCAAATTGG + Intronic
1159448349 18:68567618-68567640 CTATGATTATGTGGACTAATGGG + Intergenic
1159518014 18:69482588-69482610 GTGAGATTATATAGTAAAATTGG + Intronic
1160291203 18:77595592-77595614 CTGTGTTTATATTGCCAAATTGG - Intergenic
1168305387 19:55432477-55432499 CTGTGATGATGTTGTGAAAAGGG + Exonic
926156544 2:10457798-10457820 CTGTGATTGTGAAGGCAAAGAGG - Intergenic
926613521 2:14971661-14971683 TTGTCAGTAAGTAGTCAAATTGG - Intergenic
928013507 2:27632578-27632600 CTGTGATTTTGTGTTGAAATCGG + Intronic
929003991 2:37378010-37378032 CTGTGCTTATGTAGTGGAATGGG + Intergenic
930213871 2:48672703-48672725 CTGTGATTATGTAGTCAAATGGG + Intronic
932836326 2:75041381-75041403 CTCTTATTATGTAGCCAAAAAGG + Intergenic
936609023 2:113983415-113983437 CTGCAATTTTGTTGTCAAATTGG + Intergenic
937819932 2:126298564-126298586 CTGTGAAAATGTAGTCTAAAGGG + Intergenic
940225627 2:151398439-151398461 CCCTGATGATGAAGTCAAATTGG + Intergenic
940807146 2:158200481-158200503 CTGTCAATATGTAAGCAAATGGG - Intronic
941280374 2:163542616-163542638 TGGTGAATATGTAGTGAAATTGG - Intergenic
942774019 2:179558949-179558971 CTGTGAGTATGGGGTAAAATTGG + Intronic
945230666 2:207585945-207585967 CAGTGATTATTTTGTTAAATAGG - Intronic
945618334 2:212101935-212101957 CTGTGAGAATGCAGACAAATTGG - Intronic
945872083 2:215238112-215238134 CTTTGTTTATGTACCCAAATTGG - Intergenic
1169665932 20:8035577-8035599 AAGTGACTGTGTAGTCAAATTGG - Intergenic
1170863840 20:20135124-20135146 ATGTGATTATGGAATCAGATTGG + Intronic
1170945019 20:20883674-20883696 CTGAGATTATGTAGACACACAGG + Intergenic
1171952832 20:31436660-31436682 CTGTGATAATTCAGTGAAATAGG + Intergenic
1178254473 21:31039304-31039326 CTGTGACTGTGGAGTCAGATGGG - Intergenic
1178698101 21:34811334-34811356 CTGTGACAAGGTAGTCAGATGGG - Intronic
1181306826 22:21921773-21921795 TTGTGAATTTGTAATCAAATTGG - Exonic
949754679 3:7395314-7395336 CTATGATCATGTATTCAAGTTGG + Intronic
953012588 3:39041279-39041301 CAGTGATTATTTCATCAAATAGG - Intergenic
953220564 3:40967937-40967959 CAGTTATTATTTTGTCAAATAGG + Intergenic
953448966 3:42990630-42990652 CTGTCATTAAGTAGACAAGTAGG - Intronic
955108192 3:55920876-55920898 CTGTTCTTCTGTGGTCAAATGGG - Intronic
956273096 3:67468870-67468892 GTTTGATTATGTAGTCATACAGG - Intronic
956566226 3:70641300-70641322 CTGTGATTTTGGTGTCAAATTGG + Intergenic
956640423 3:71410532-71410554 TTATGATTATGCAGTCAAAAAGG + Intronic
957012028 3:75017686-75017708 CTGGGAGTATGTATTCCAATAGG + Intergenic
957940658 3:86998874-86998896 CTGTGATTTATTAGTCCAATTGG - Intergenic
959594566 3:108115043-108115065 CTCTGAATGTGCAGTCAAATGGG - Intergenic
963887178 3:150595925-150595947 TTGTGATTTTGTAGGAAAATGGG - Intronic
963932664 3:151020195-151020217 CCATTTTTATGTAGTCAAATAGG + Intergenic
965646310 3:170885037-170885059 CTTTCATTATGTATTCTAATTGG + Intergenic
965913162 3:173807159-173807181 CTGTAATTATGTTCACAAATTGG + Intronic
966305567 3:178530214-178530236 CTGTGTGCATGTGGTCAAATGGG - Intronic
967252745 3:187559805-187559827 CTATTATTATGTTATCAAATTGG + Intergenic
975282371 4:72575859-72575881 CTGTGTTTATGAAATAAAATTGG - Intergenic
976257305 4:83111786-83111808 ATGTGTTTTTGTATTCAAATTGG + Intronic
977246726 4:94640100-94640122 CTGTGACTATGTAGGTAAATGGG - Intronic
978497636 4:109377320-109377342 CTGTGAGTATGTAGAGAGATGGG + Intergenic
981772898 4:148330651-148330673 CTTTGAATATAAAGTCAAATGGG - Intronic
983969505 4:173854210-173854232 CTGTGATTTCATATTCAAATTGG + Intergenic
985315736 4:188657261-188657283 CTGTGTATATGTGGTGAAATGGG - Intergenic
986458926 5:7949496-7949518 CTGTGATTTTGGTGTCAAAAGGG - Intergenic
990021370 5:51131124-51131146 CAGTGATGATGTAATCATATTGG + Intergenic
992091182 5:73318550-73318572 TTGTGATTATGTACTCAAACGGG - Intergenic
994219454 5:97178892-97178914 CTGTGATTATTTTGACTAATAGG + Intronic
995810251 5:116098719-116098741 CTGTGATTCTGAATTCAAAGAGG + Intronic
996325236 5:122265806-122265828 CTGTGATTATGTAGAGCAACAGG - Intergenic
996488174 5:124060956-124060978 GTGTGACTTTGAAGTCAAATTGG - Intergenic
996491534 5:124103887-124103909 TTGTGTTTATGTGGTCAGATGGG - Intergenic
998344182 5:141446798-141446820 TTGTGATCATCTAGTCAGATGGG + Intronic
999807524 5:155096890-155096912 CTGTAATTTTGTAGTCACTTTGG - Intergenic
1000347379 5:160325882-160325904 CTGTGAATATATAAACAAATGGG - Intronic
1001032954 5:168276114-168276136 CTGTGATGATGTAGTGATAGTGG - Intergenic
1004521128 6:16361935-16361957 GTGTGATTATCTGGTGAAATTGG + Intronic
1005400326 6:25425592-25425614 CTGTGATTATTTGCTGAAATGGG + Intronic
1005880141 6:30050873-30050895 GTGTAATTATGTAGTCACTTTGG + Intergenic
1008261786 6:49375150-49375172 CTGAGATTAAGTAGAAAAATTGG - Intergenic
1008682275 6:53885550-53885572 CTCTGCTTATGTGGTCAGATGGG + Intronic
1014682328 6:124447128-124447150 GAGTGATTATGTGGTCAAAGAGG - Intronic
1015976348 6:138795359-138795381 CTGGGAGTATGTACACAAATAGG - Intergenic
1017046103 6:150348555-150348577 CTGTGATGATGGAGGCAGATTGG - Intergenic
1017308210 6:152945353-152945375 CTTTGGAAATGTAGTCAAATTGG - Intergenic
1018920305 6:168167909-168167931 CTGTGGTTGTGCAGTCTAATGGG + Intergenic
1020914596 7:14176769-14176791 TTGTGGTTATTTAGTCAAAGAGG + Intronic
1021821434 7:24501389-24501411 TTCTTATTATGTAGCCAAATTGG - Intergenic
1021862377 7:24919131-24919153 TTGTCATTATGAAGTCATATTGG - Intronic
1023261872 7:38366898-38366920 TTGTGATTATGTACACAAAAAGG + Intergenic
1023999840 7:45183034-45183056 CTGTGAATAGGTGGCCAAATGGG + Intronic
1028727063 7:94100209-94100231 ATGTGAGTATGTAGGAAAATGGG + Intergenic
1031154255 7:118090480-118090502 CTGGGACTATTTAGTCAGATGGG + Intergenic
1031878014 7:127163606-127163628 CTGTGATTATTTTTTCAAGTGGG + Intronic
1032601187 7:133297208-133297230 GTCTGATTATTTGGTCAAATCGG + Intronic
1032769446 7:135034952-135034974 CTGTGCTTATTTAGTAAACTTGG + Intronic
1033680560 7:143590780-143590802 CTGTGGTTTTGAAGTAAAATTGG - Intergenic
1033704334 7:143871032-143871054 CTGTGGTTTTGAAGTAAAATTGG + Intronic
1035035923 7:155893661-155893683 CTGTGAATAAGTTGACAAATTGG - Intergenic
1035101479 7:156401026-156401048 CTGTAATTAAGAAATCAAATAGG - Intergenic
1036114528 8:5944486-5944508 CTTTGATTATGAAGTAAAGTAGG - Intergenic
1036520430 8:9486593-9486615 CTATAATGATGTAGACAAATAGG + Intergenic
1036969995 8:13344925-13344947 GTTTGATTATTTAATCAAATTGG + Intronic
1040886564 8:52269697-52269719 GTGGGATTATGTCGTCAAAATGG + Intronic
1041168750 8:55118979-55119001 ATGTGATCATGTAGTTATATAGG + Intronic
1042145321 8:65722309-65722331 CTGTCACTCTGAAGTCAAATCGG + Intronic
1042481546 8:69309027-69309049 CTGTGATCATGAAGGCAAAGGGG + Intergenic
1043166339 8:76907675-76907697 TTGTGAACATGAAGTCAAATGGG + Intergenic
1043286600 8:78539678-78539700 ATGTGATTATGTAGTCCACAAGG + Intronic
1044467868 8:92527526-92527548 CTGTTATTATTTTGTTAAATAGG - Intergenic
1045917607 8:107490964-107490986 CTGCCATTATGTAGTTAAAAAGG + Intronic
1047017295 8:120736787-120736809 GTGTGGTTATGTAATCAAAACGG - Intronic
1049132781 8:140862945-140862967 CTGTGAAGAAGTAGTCACATAGG - Intronic
1050062708 9:1727201-1727223 ATGTGATTCTGTAGTCAATGAGG + Intergenic
1050064260 9:1742351-1742373 ATGTGATTATGTGGTCATCTTGG + Intergenic
1051381003 9:16458432-16458454 TTTTGATTTTGTATTCAAATAGG + Intronic
1054926569 9:70595304-70595326 CTGTGATTACATAATCAGATTGG - Intronic
1055696885 9:78894665-78894687 CTGTGATTATGCACTCAGCTTGG + Intergenic
1055937213 9:81614361-81614383 CTTTGGTTATGTAGGCAAGTGGG - Intronic
1056447611 9:86681056-86681078 TTTTTATTGTGTAGTCAAATAGG + Intergenic
1057065971 9:92052021-92052043 CATTGAATATGTAGTCACATTGG - Intronic
1199535047 X:148893250-148893272 CTGTGCTAATATAGCCAAATGGG - Intronic
1200770744 Y:7123062-7123084 ATGTGATTATGCAGATAAATTGG - Intergenic
1202030685 Y:20571154-20571176 CTTTGATTATATTGTCAACTAGG + Intergenic