ID: 930215845

View in Genome Browser
Species Human (GRCh38)
Location 2:48696371-48696393
Sequence CAAGTTTCCCTGAGGGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930215842_930215845 4 Left 930215842 2:48696344-48696366 CCAAAAGGTTGCTTGGTGAAGTC 0: 1
1: 0
2: 1
3: 5
4: 102
Right 930215845 2:48696371-48696393 CAAGTTTCCCTGAGGGCAGTAGG 0: 1
1: 0
2: 1
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930215845 Original CRISPR CAAGTTTCCCTGAGGGCAGT AGG Intronic
901224621 1:7605989-7606011 CAAGCTCCCCCGAGGGCAGGAGG - Intronic
902724516 1:18325863-18325885 CAAGATGCCGTGAGGGCAGCCGG + Intronic
902785466 1:18730331-18730353 ACAGTTTCCCCGAGGGCACTGGG - Intronic
903575541 1:24337568-24337590 GAAGTCTCCTAGAGGGCAGTGGG - Intronic
904130927 1:28274566-28274588 CAAGATTCCACGAGGGCAGTGGG + Intronic
905662638 1:39739104-39739126 CACTTTTTCCTGAGGACAGTGGG - Intronic
906614831 1:47226787-47226809 AAGGGTTCCCTGAGGCCAGTGGG + Intronic
908013586 1:59808863-59808885 CAAGTTTGAATGAGGGGAGTTGG - Intergenic
908639511 1:66206212-66206234 CAAGTTTCCCTGAAGGAAACTGG - Intronic
909595873 1:77405695-77405717 CAAGTTTTCCTAGGGGGAGTTGG - Intronic
911315556 1:96352827-96352849 CAAGTCTCCCTGGGTGCAATTGG + Intergenic
915206228 1:154272471-154272493 CCAGTTTCCGTGACGGGAGTGGG - Intergenic
915744047 1:158142473-158142495 CATCTTTCTCTGAGGGCAGCTGG - Intergenic
918208973 1:182334082-182334104 AAAGTTTCCCTGAGGGGTTTGGG + Intergenic
921176687 1:212601282-212601304 AAAGTATCCCTGAGGGCACAGGG + Intronic
923334256 1:232953101-232953123 CAAGTTCCACTGGGGGCAGCTGG - Intronic
924769468 1:247066378-247066400 CAAGTGTCCATGGGGGCTGTAGG - Intronic
1063975039 10:11408317-11408339 CAAGGGTGGCTGAGGGCAGTGGG - Intergenic
1064991410 10:21259905-21259927 CATGTCACCCTGAAGGCAGTTGG + Intergenic
1065733893 10:28733993-28734015 GAATTCTCCCTGAGGGCAGAAGG - Intergenic
1069563237 10:69446111-69446133 CTAGTTTCACTGAGGGCCATTGG - Intergenic
1070895426 10:79980031-79980053 CTTCTTTCCTTGAGGGCAGTGGG - Intronic
1070968492 10:80544468-80544490 ACAGTTTCCATGAGGGCAGTGGG - Intronic
1074089027 10:110229346-110229368 CAAATTTCCCTGAAGGCTTTGGG + Intronic
1075384256 10:122043390-122043412 CAAAATTCCATGAGGGTAGTAGG + Intronic
1077575882 11:3382944-3382966 AAAGTCTCCATGAGGGCACTGGG + Intergenic
1084675216 11:70630128-70630150 GAAGGTTCCCTGATGGCAGTGGG + Intronic
1085643185 11:78206157-78206179 CATGATTCCCTGAGGTCTGTGGG + Intronic
1088158063 11:106833188-106833210 CAAGTTACAATGAGGCCAGTAGG - Intronic
1089064289 11:115650613-115650635 GAAGGTTCCCTGGGGGCAGCAGG - Intergenic
1089092243 11:115887793-115887815 TAAGTTTCCCTGACAGCAGAAGG - Intergenic
1092767966 12:11870080-11870102 CAAGGCTCTCTGAGGGCAATTGG + Intronic
1094082971 12:26557518-26557540 CAAGCTGCCTTGAGAGCAGTAGG - Intronic
1094133186 12:27097069-27097091 CAAGTATGCCTGATGTCAGTGGG - Intergenic
1095296308 12:40531215-40531237 CAACTTTCCCAGGAGGCAGTGGG + Intronic
1095606479 12:44073518-44073540 AAAGTCTCCTTGAGAGCAGTTGG - Intronic
1095651502 12:44616206-44616228 AAAGTTTCTCTGAGGGTAGTGGG - Intronic
1095749995 12:45699213-45699235 CCAGTTTCCCCAAGGGCAGAGGG - Intergenic
1097681262 12:62651558-62651580 CTCATTTCCCTGAGGGCTGTAGG + Intronic
1098793809 12:74863339-74863361 CAACTTTCCCTGTGGGTAGATGG - Intergenic
1100331021 12:93582314-93582336 GAATTTATCCTGAGGGCAGTAGG + Intronic
1105458161 13:20560105-20560127 ATGGTTTCCCTGAGGTCAGTGGG - Intergenic
1106265816 13:28108736-28108758 CAAGTTACACTGAGGTCATTGGG - Intergenic
1107708154 13:43127299-43127321 CCAGTTGCCCTGTGGGCAGAGGG - Intergenic
1107826920 13:44337092-44337114 CAACTTTTCCTGAGGGCACATGG - Intergenic
1113465412 13:110509134-110509156 AAAGTCTCACTGAGGACAGTGGG + Intronic
1115307207 14:31945221-31945243 CAAGTGTGCCTGAGGACAGAGGG + Intronic
1116888458 14:50243084-50243106 CCACTTTCCCTGAGGCCATTTGG - Exonic
1119887458 14:78154840-78154862 CAGGTCTACCTGAGGTCAGTGGG - Intergenic
1121211127 14:92208512-92208534 CAAGCTTCACTGAAGACAGTAGG - Intergenic
1121327169 14:93027933-93027955 CAAGTCACCCAGAGAGCAGTGGG + Intronic
1121745239 14:96284103-96284125 CAAGTTTCCTTAAGGGCAAATGG + Exonic
1122313020 14:100809192-100809214 CAAGTCTCCCTCAGGGCGGAGGG - Intergenic
1122359378 14:101150559-101150581 TCAGTCTCCCTGAGGGGAGTGGG + Intergenic
1124407421 15:29404743-29404765 CATGTTTCCATCAGGCCAGTGGG - Intronic
1125015481 15:34929790-34929812 CCAGTTTCTCTGATGGCAGAAGG - Intronic
1125088513 15:35761232-35761254 TAAGTCTGCCTAAGGGCAGTGGG + Intergenic
1125750131 15:42022215-42022237 CAAGTTTCCCTGTGGTGAGAGGG + Intronic
1128356809 15:66933875-66933897 GATGTGTCCCTGAGGGTAGTGGG - Intergenic
1131721703 15:95176036-95176058 GAAGATTCCTTGAGGCCAGTAGG - Intergenic
1132772928 16:1574662-1574684 CTGGTCACCCTGAGGGCAGTTGG - Intronic
1136566315 16:31072906-31072928 AAAGTATTCCTGAGGGCACTAGG - Intronic
1137712052 16:50573346-50573368 GAAGTTGCCCTGTGGGCAGGTGG + Intronic
1138891128 16:61145387-61145409 CAATTTTCTCTAAGGGCACTTGG - Intergenic
1140679160 16:77367372-77367394 CAGGTTTTCCTGAGTGCTGTTGG - Intronic
1141999305 16:87655037-87655059 CCAGTTTGCCTGGGGTCAGTGGG + Intronic
1147165536 17:38591284-38591306 CAGGTTCCCCTGAGGGCCATGGG - Intronic
1147607402 17:41782035-41782057 CTGGATTCCCTGAGGGCAGGCGG - Intronic
1147776142 17:42902937-42902959 CAAGATTCCCTGAGGCCTGAGGG + Intronic
1148341196 17:46874505-46874527 CCAGATTCCCAGAGGGCAGCAGG - Intronic
1149546019 17:57504489-57504511 GATATTTCCCTGTGGGCAGTCGG + Intronic
1154016684 18:10625366-10625388 CAAGGGTCCCTGAAGGCAGTGGG - Intergenic
1154188832 18:12210295-12210317 CAAGGGTCCCTGAGGGCAGTGGG + Intergenic
1158322866 18:56282459-56282481 CAACTTTCCATGAAGGCAATGGG + Intergenic
1160497141 18:79382328-79382350 AAAGTGTCCCTGAGGGCAGAGGG - Intergenic
1164651569 19:29894472-29894494 CAATCTTCCCTGATGACAGTCGG - Intergenic
1164990705 19:32680693-32680715 TGTGTTTCACTGAGGGCAGTGGG + Intergenic
1165636747 19:37346829-37346851 AAGGCTTCCCTGAGGGAAGTAGG - Intronic
1166081410 19:40446032-40446054 CGAGTTTCCCTAAGGGGAGGAGG + Intergenic
1167770070 19:51509352-51509374 TGGGTTTCCCTGAGGGCAGTGGG + Intergenic
924998609 2:386269-386291 CCAGTTTCCCTGAGAGGAGGTGG + Intergenic
925280739 2:2682905-2682927 CAGCTTTCCCTGTGGGCGGTGGG - Intergenic
926657247 2:15421481-15421503 CAAGTTTCGCTAAAGGCACTAGG + Intronic
927844364 2:26463808-26463830 CAAGTTACCCTGAGGGGCCTTGG + Intronic
928658568 2:33478108-33478130 CGAGTTTCCCTCAGCACAGTGGG + Intronic
930215845 2:48696371-48696393 CAAGTTTCCCTGAGGGCAGTAGG + Intronic
931208706 2:60172037-60172059 CAAGTTTCCTTGTGGGGAGAGGG - Intergenic
931610049 2:64089293-64089315 CCAGTTTCCCTGAAGGAAATAGG - Intergenic
932581245 2:72993984-72994006 CCAGGTACCCTGAGAGCAGTGGG - Intronic
935268608 2:101414953-101414975 CAAGTTCTCATGTGGGCAGTGGG + Intronic
937417901 2:121731562-121731584 GAATTTATCCTGAGGGCAGTGGG - Intronic
937778313 2:125807787-125807809 TAATTTTCCCTTAGGGCTGTTGG - Intergenic
938308526 2:130269908-130269930 ACATTGTCCCTGAGGGCAGTAGG + Intergenic
938446803 2:131386928-131386950 ACATTGTCCCTGAGGGCAGTAGG - Intergenic
938630370 2:133160201-133160223 CAGGGCTCCCTGAAGGCAGTAGG + Intronic
938804087 2:134789705-134789727 CAGGGTTCACTGAGGGCTGTTGG + Intergenic
940761413 2:157742904-157742926 CAGATCTCACTGAGGGCAGTGGG - Intronic
941054888 2:160776616-160776638 CAAATGTCCATGTGGGCAGTGGG - Intergenic
941359375 2:164532886-164532908 CTCGTTTCCCAGAGGGCAGAGGG - Intronic
941744453 2:169071644-169071666 CCTGCTTCCCTGAGGGCAGGAGG - Intronic
942595285 2:177586450-177586472 GACATTTCCCTGATGGCAGTTGG - Intergenic
943266275 2:185737317-185737339 CACTTTGCGCTGAGGGCAGTTGG + Intergenic
948305965 2:236947023-236947045 CAAATTTCCCTGGGGTCAGCTGG + Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171014914 20:21531316-21531338 CTATTTTCCCTGAGGGAAGATGG + Intergenic
1171365392 20:24619199-24619221 CAAGTTTGGCTGAGGGCTGAGGG - Intronic
1172044678 20:32071799-32071821 CCAGTTTCCCTGGGGGCTGACGG + Intronic
1173864404 20:46305218-46305240 CAACTTTTCATCAGGGCAGTGGG - Intronic
1175409839 20:58760022-58760044 CAAGTTTCCCTTAGTTCAGAGGG + Intergenic
1175905836 20:62378905-62378927 CACATTTCCCAGAGGGCAGGAGG + Intergenic
1178733918 21:35131667-35131689 CAGGCTTCCCTGAGAGCAGATGG + Intronic
1179128225 21:38611370-38611392 CCAGGTTCCCTAAGGGCCGTGGG - Intronic
1179982895 21:44905727-44905749 CAGGTGTCCCTGGGGGCAGCAGG - Intronic
1180915573 22:19484085-19484107 CAAGGTGTACTGAGGGCAGTGGG + Intronic
949409946 3:3752940-3752962 CATGTTTCCATGACTGCAGTTGG + Intronic
950452312 3:13072327-13072349 CAGGCTTCCCAGGGGGCAGTGGG - Intronic
954611767 3:51948116-51948138 CAAGTTTCCCAGAGAGAAGTCGG + Intronic
956932753 3:74064093-74064115 CAAGTTAACATGAGGTCAGTAGG - Intergenic
961980599 3:131074057-131074079 CAGTTATCACTGAGGGCAGTTGG - Intronic
962389604 3:134960195-134960217 CAGGTCTCCCTCAGTGCAGTAGG + Intronic
964296603 3:155240384-155240406 CAAGTGTCCATGAGGGATGTGGG + Intergenic
964444288 3:156742368-156742390 CAAGCTTCCCTGAGAACAGTGGG - Intergenic
965635825 3:170779182-170779204 GAAGTTTCCCTTAGGGTGGTAGG + Intronic
972921254 4:43945003-43945025 CAAGTTTTCCTTGAGGCAGTAGG - Intergenic
981583296 4:146272352-146272374 CAAGTTACCCTAGGGGCAGGAGG - Intronic
985063589 4:186101458-186101480 CAAGTTAAGCTGAGGTCAGTAGG - Intergenic
988015523 5:25553072-25553094 CAAGTTTCCCTGCGAACATTTGG + Intergenic
992376520 5:76193289-76193311 CACCTTTCCCTGAAGGCATTTGG - Intronic
993033766 5:82734298-82734320 CAGGTTTCCCTGAGGTCATTTGG + Intergenic
993241034 5:85385575-85385597 GAAATATCCCTGAGGGCAGGAGG - Intergenic
993889148 5:93451854-93451876 CAAGCATGCTTGAGGGCAGTGGG + Intergenic
994183826 5:96797084-96797106 GAAGTCTGCCTGAGCGCAGTGGG - Intronic
995442911 5:112211702-112211724 CAAGTTTCCTCCAGAGCAGTTGG + Intronic
995893233 5:116981126-116981148 CAAGTGTCCCAGAGGGCACGTGG + Intergenic
996131191 5:119783063-119783085 AAAATTTCCATGAGGGCACTTGG + Intergenic
998521153 5:142801810-142801832 AATGTTTCCCTAAGGGCTGTGGG - Intronic
998911825 5:146968072-146968094 CAAGTTTCCCCAAGGGCATGTGG - Intronic
1001679314 5:173544472-173544494 AAAGTTTCCCGGAGTCCAGTGGG - Intergenic
1004481728 6:16025833-16025855 CAAGTCTGTCTGAGGGCAGCTGG + Intergenic
1005350523 6:24930445-24930467 CAGGTTACCCTGAGGTCACTGGG + Intronic
1008565571 6:52764711-52764733 CAAGTTGGCCTGAGAGCAGAGGG + Intergenic
1008569756 6:52805049-52805071 CAAGTTGGCCTGAGAGCAGAGGG + Intergenic
1010387630 6:75300455-75300477 CAAGTTGTTCTGAGGCCAGTAGG - Intronic
1010808173 6:80263721-80263743 CAATTTTCCCTGAAGCCAGCTGG - Intronic
1011025638 6:82866510-82866532 TAACTTTCCATGAGGGCAGCTGG - Intergenic
1016035393 6:139377965-139377987 CAAGTTAACATGAGGCCAGTAGG - Intergenic
1016447337 6:144147615-144147637 CAAGTTGTCATGAAGGCAGTTGG - Intergenic
1020804532 7:12772374-12772396 CAGGTTACTCTGAGGGAAGTGGG + Intergenic
1021802973 7:24326170-24326192 GAAGTTTTACTGAGGGCACTAGG - Intergenic
1023025597 7:36047161-36047183 CAGGCTTCCCTGAGAGCAGTAGG - Intergenic
1023093007 7:36633670-36633692 CATGTTACCCTGAGGACTGTGGG + Intronic
1024511442 7:50207719-50207741 CAACGTTCCCTGAGGGGAGTTGG - Intergenic
1026431081 7:70347810-70347832 CAAGTCTCCCAGAGGGTAGAAGG - Intronic
1028928214 7:96383443-96383465 CAAGATTCTCTGAGGGCCTTGGG + Intergenic
1029039013 7:97553436-97553458 CAAGTTTCCCTTAGGGAAATGGG + Intergenic
1029993737 7:104986110-104986132 CAGGATACCCTGAAGGCAGTAGG + Intergenic
1030756480 7:113292488-113292510 CAAGTTTCCCTCAGGCCTGTTGG - Intergenic
1032158029 7:129485993-129486015 CAACTTGCCCTGGGGTCAGTTGG + Exonic
1032355060 7:131203421-131203443 AAATTTTCCCTGTGGGCAATTGG + Intronic
1032510262 7:132466635-132466657 GAAGTTCCCCTGGTGGCAGTGGG + Intronic
1032543637 7:132724545-132724567 CATTTGTTCCTGAGGGCAGTAGG - Intronic
1032695233 7:134330245-134330267 CAAGTTTTCCTTATGTCAGTGGG - Intergenic
1034438475 7:151074933-151074955 CAAGGTTCCCTGAGGTCCCTGGG - Intronic
1034877697 7:154739831-154739853 CCAGTGTCCCAGAGGACAGTGGG + Intronic
1035274516 7:157739619-157739641 CAAGAGTCCCAGATGGCAGTTGG - Intronic
1039254461 8:35703979-35704001 CTAGTTTTCCTGAGAGCAGGTGG - Intronic
1040857469 8:51962719-51962741 AAAGTTTGCCTGAGGCCAGAAGG + Intergenic
1041240193 8:55842580-55842602 GAAGTTTCCCTTAGGATAGTTGG - Intergenic
1041917176 8:63149382-63149404 GAAGTTTCAGTGGGGGCAGTAGG + Intergenic
1044765794 8:95572536-95572558 GAAATTTGGCTGAGGGCAGTTGG + Intergenic
1044870448 8:96614706-96614728 AAACTTTCCCAGAGGCCAGTTGG - Intergenic
1047646669 8:126877352-126877374 CAAGTTTCACTGGGGGCAGAAGG - Intergenic
1049763872 8:144343874-144343896 CCAGGTTCCCTGAAGGCATTTGG + Intergenic
1051155844 9:14144969-14144991 CATTTTTTCCTGAGAGCAGTGGG + Intronic
1052568162 9:30185572-30185594 CAAGTTTCCCAGAGGGCCCATGG - Intergenic
1053222319 9:36322751-36322773 AAAATATCCCTGAGGGCAGAGGG - Intergenic
1058907653 9:109494899-109494921 CAAGTTAACCTGGGGGCAGTGGG + Intronic
1058916162 9:109568184-109568206 CAAATGTCCATGAGGGCCGTGGG - Intergenic
1061988051 9:134141848-134141870 GAAGATTTCCTGAGGGCAATGGG + Intronic
1062502603 9:136857819-136857841 CAAGCTTCCCTGAGCCCACTGGG - Intronic
1062725608 9:138071769-138071791 CAAGATTCCCTGAAGACACTGGG - Intronic
1187775772 X:22755028-22755050 CAAGTATGCCTGATGACAGTTGG - Intergenic
1187802581 X:23080596-23080618 TAAGTTGCCCAGAAGGCAGTTGG + Intergenic
1195535841 X:106008482-106008504 CAAGTTTCCAAGAAGCCAGTTGG - Intergenic
1196612043 X:117726599-117726621 AGAATGTCCCTGAGGGCAGTAGG + Intergenic
1196818736 X:119686171-119686193 CAGGCTCCCCAGAGGGCAGTTGG - Intronic